Web document 7.3. Myoglobin sequences used for phylogenetic analyses. The file contains 12 myoglobin DNA coding sequences and human cytoglobin (as an outgroup).

 

Contents of this document:

[1] 13 DNA coding sequences obtained from NCBI Nucleotide. Note that each begins with ATG and ends with a stop codon (TAG, TGA, or TAG).

[2] The same 13 sequences with the names edited to be shorter.

[3] A multiple sequence alignment of these 13 sequences using MAFFT at EBI.

[4] The result of converting this multiple sequence alignment into the NEXUS format by using the ReadSeq program at Baylor College of Medicine.

[5] A multiple sequence alignment of these 13 sequences using ProbCons (Chapter 6), displayed in the ClustalW format.

[6] A multiple sequence alignment of these 13 sequences using ProbCons (Chapter 6), displayed in the MFA format.

 

 

[1] 13 DNA coding sequences obtained from NCBI Nucleotide. Note that each begins with ATG and ends with a stop codon (TAG, TGA, or TAG).

 

 
>gi|44955876:81-545 Homo sapiens myoglobin (MB), transcript variant 1, mRNA
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAG
GCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGTGCCACCGTGCTC
ACCGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC
ATGCCACCAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCA
GAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG
>gi|114686145:195-659 PREDICTED: Pan troglodytes similar to Myoglobin, transcript variant 5 (LOC740117), mRNA
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAG
GCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGCGCCACCGTGCTC
ACTGCCCTGGGTGGCATCCTGAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC
ATGCCACCAAGCACAAGATCCCTGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCA
CAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG
>gi|55728441:74-538 Pongo pygmaeus mRNA; cDNA DKFZp468H096 (from clone DKFZp468H096)
ATGGGGCTCAGCGATGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAA
GCCACGGGCAAGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGATGAGATGAAGGCGTCTGAGGACCTAAAGAAGCATGGCGCCACCGTGCTC
ACTGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC
ATGCCACGAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATCCATCATCCAGGTTCTGCA
GAGCAAGCATCCCGGAGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG
>gi|109094012:200-664 PREDICTED: Macaca mulatta similar to Myoglobin, transcript variant 4 (MB), mRNA
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAA
GCCACGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCTGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACCTAAAGAAGCATGGCGTCACCGTGCTC
ACTGCCTTGGGCGGCATCCTTAAGAAGAAGGGGCATCACGAGGCGGAGATTAAGCCCCTGGCGCAGTCGC
ATGCCACCAAGCACAAGATCCCTGTGAAGTACCTGGAGTTGATCTCGGAATCCATCATCCAAGTTCTGCA
GAGCAAGCATCCCGGGGACTTCGGTGCCGACGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AACGACATGGCCGCCAAGTACAAAGAGCTGGGCTTCCAGGGTTAG
>gi|47523545:60-524 Sus scrofa myoglobin (MB), mRNA
ATGGGGCTCAGCGACGGGGAATGGCAGCTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGATGTCGCAG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTTAAGGGTCACCCCGAGACCCTGGAGAAATTTGACAAGTT
TAAGCACCTGAAGTCAGAGGATGAGATGAAGGCCTCTGAGGACCTGAAGAAGCACGGCAACACGGTGCTG
ACTGCCCTGGGGGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGCTGACGCCCCTGGCCCAATCGC
ATGCCACCAAGCACAAGATCCCTGTCAAGTACCTGGAGTTCATCTCAGAAGCCATCATCCAGGTTCTGCA
GAGCAAGCATCCTGGGGACTTTGGTGCTGACGCCCAGGGAGCCATGAGCAAGGCCCTGGAACTCTTCCGG
AACGACATGGCGGCCAAGTACAAGGAGCTGGGCTTCCAGGGCTAA
>gi|73969213:257-721 PREDICTED: Canis familiaris similar to Myoglobin, transcript variant 1 (LOC608715), mRNA
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACATCTGGGGGAAGGTGGAGACTGACCTGGCGG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTTAAGAACCACCCCGAGACCCTGGATAAGTTCGACAAGTT
CAAGCACCTGAAGACAGAGGATGAGATGAAGGGCTCCGAGGACCTGAAGAAGCATGGCAACACCGTGCTC
ACCGCCCTGGGGGGCATCCTTAAGAAGAAGGGGCATCACGAGGCCGAGCTGAAGCCCCTGGCCCAGTCAC
ATGCCACCAAGCACAAGATCCCCGTCAAGTACCTGGAGTTCATCTCAGATGCCATCATCCAGGTCCTGCA
GAGCAAGCATTCCGGGGACTTCCACGCCGACACCGAGGCGGCCATGAAAAAGGCCCTGGAGCTGTTCCGG
AATGACATCGCCGCCAAGTACAAGGAGCTGGGGTTCCAGGGCTAA
>gi|113374036:66-530 Physeter catodon Mb mRNA for myoglobin, complete cds
ATGGTGCTCAGCGAGGGAGAATGGCAGTTGGTTCTGCACGTCTGGGCGAAGGTGGAGGCTGATGTCGCAG
GCCATGGGCAGGACATCCTCATCAGGCTCTTTAAGAGTCATCCCGAGACCCTGGAGAAATTTGACAGGTT
CAAGCACCTGAAGACAGAGGCTGAGATGAAGGCCTCAGAGGACCTGAAGAAGCATGGCGTCACCGTGCTC
ACTGCCCTGGGGGCCATCCTCAAGAAGAAGGGGCATCATGAGGCGGAGCTGAAGCCCCTGGCCCAGTCGC
ATGCTACCAAGCACAAGATCCCCATCAAGTACCTGGAGTTCATCTCGGAAGCCATCATCCACGTTCTGCA
CAGCAGGCACCCTGGAGACTTTGGTGCCGACGCCCAGGGAGCCATGAACAAGGCCCTGGAACTGTTCCGG
AAGGACATCGCTGCCAAGTACAAGGAGCTGGGCTACCAGGGCTAA
>gi|116282340:1-465 Ovis aries myoglobin mRNA, complete cds
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAATGCCTGGGGGAAGGTGGAGGCTGGTGTCGCAG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAATTTGACAAGTT
CAAGCACCTGAAGACAGAGGCTGAGATGAAGGCCTCCGAGGACCTGAAGAAGCATGGCAACACCGTGCTC
ACGGCCCTAGGGGGTATCCTGGAAAAGAAGGGTCACCACGAGGCGGAGGTGAAGCACCTGGCCGAGTCAC
ACGCCAACAAGCACAAGATCCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCTGCA
TGCCAAGCATCCTTCAGACTTCGGTGCTGATGCACAGGGCGCCATGAGCAAGGCCCTGGAACTGTTCCGG
AACGACATGGCTGCCCAGTACAAGGTGCTGGGCTTCCAGGGCTAA
>gi|48976077:28-492 Rattus norvegicus myoglobin (Mb), mRNA
ATGGGGCTCAGTGATGGGGAGTGGCAGATGGTGCTGAACATCTGGGGGAAAGTGGAGGGCGACCTTGCTG
GCCATGGACAGGAAGTCCTCATCAGTCTATTTAAGGCTCACCCCGAGACCCTGGAAAAGTTCGACAAGTT
CAAGAACCTGAAATCCGAGGAAGAGATGAAGAGTTCAGAGGACCTGAAGAAGCACGGCTGCACCGTGCTC
ACAGCCCTGGGTACCATCCTGAAGAAGAAGGGACAACATGCTGCTGAGATCCAGCCTCTGGCCCAGTCCC
ACGCCACCAAGCACAAGATCCCGGTCAAGTACCTGGAGTTTATCTCAGAAGTCATCATCCAAGTCCTGAA
GAAGAGATATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCCTGGAGCTGTTCCGG
AATGACATTGCTGCCAAGTACAAGGAGCTGGGCTTCCAGGGCTGA
>gi|21359819:165-629 Mus musculus myoglobin (Mb), mRNA
ATGGGGCTCAGTGATGGGGAGTGGCAGCTGGTGCTGAATGTCTGGGGGAAGGTGGAGGCCGACCTTGCTG
GCCATGGACAGGAAGTCCTCATCGGTCTGTTTAAGACTCACCCTGAGACCCTGGATAAGTTTGACAAGTT
CAAGAACTTGAAGTCAGAGGAAGATATGAAGGGCTCAGAGGACCTGAAGAAGCATGGTTGCACCGTGCTC
ACAGCCCTGGGTACCATCCTGAAGAAGAAGGGACAACATGCTGCCGAGATCCAGCCTCTAGCCCAATCAC
ACGCCACCAAGCACAAGATCCCGGTCAAGTACCTGGAGTTTATCTCAGAAATTATCATTGAAGTCCTGAA
GAAGAGACATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCCTGGAGCTCTTCCGG
AATGACATTGCCGCCAAGTACAAGGAGCTAGGCTTCCAGGGCTGA
>gi|27806938:67-531 Bos taurus myoglobin (MB), mRNA
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAATGCCTGGGGGAAGGTGGAGGCTGATGTCGCAG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAATTTGACAAGTT
CAAGCACCTGAAGACAGAGGCTGAGATGAAGGCCTCCGAGGACCTGAAGAAGCATGGCAACACGGTGCTC
ACGGCCCTGGGGGGTATCCTGAAGAAAAAGGGTCACCATGAGGCAGAGGTGAAGCACCTGGCCGAGTCAC
ATGCCAACAAGCACAAGATCCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCTACA
TGCCAAGCATCCTTCAGACTTCGGTGCTGATGCCCAGGCTGCCATGAGCAAGGCCCTGGAACTGTTCCGG
AATGACATGGCTGCCCAGTACAAGGTGCTGGGCTTCCATGGCTAA
>gi|118082891:61-525 PREDICTED: Gallus gallus myoglobin (MB), mRNA
ATGGGGCTCAGCGACCAGGAGTGGCAACAAGTCCTCACCATCTGGGGAAAAGTGGAGGCCGACATTGCTG
GCCATGGACACGAGGTTCTGATGAGACTTTTCCATGACCACCCTGAGACTTTGGATCGCTTTGATAAGTT
CAAAGGCCTGAAGACCCCTGATCAGATGAAGGGCTCTGAAGATCTGAAGAAACATGGAGCTACTGTCCTC
ACCCAGCTTGGCAAAATCCTGAAGCAGAAGGGTAATCATGAGTCAGAGCTGAAGCCCCTGGCTCAAACCC
ATGCCACGAAGCACAAAATCCCAGTCAAATATCTGGAGTTCATTTCTGAAGTCATTATCAAGGTCATTGC
TGAAAAACATGCCGCAGACTTTGGGGCCGATTCCCAGGCTGCCATGAAGAAGGCTCTGGAGTTGTTCCGA
AATGACATGGCCAGCAAGTACAAGGAGTTTGGTTTCCAGGGTTAG
>gi|38454323:159-731 Homo sapiens cytoglobin (CYGB), mRNA
ATGGAGAAAGTGCCAGGCGAGATGGAGATCGAGCGCAGGGAGCGGAGCGAGGAGCTGTCCGAGGCGGAGA
GGAAGGCGGTGCAGGCTATGTGGGCCCGGCTCTATGCCAACTGCGAGGACGTGGGGGTGGCCATCCTGGT
GAGGTTCTTTGTGAACTTCCCCTCGGCCAAGCAGTACTTCAGCCAGTTCAAGCACATGGAGGATCCCCTG
GAGATGGAGCGGAGCCCCCAGCTGCGGAAGCACGCCTGCCGAGTCATGGGGGCCCTCAACACTGTCGTGG
AGAACCTGCATGACCCCGACAAGGTGTCCTCTGTGCTCGCCCTTGTGGGGAAAGCCCACGCCCTCAAGCA
CAAGGTGGAACCGGTGTACTTCAAGATCCTCTCTGGGGTCATTCTGGAGGTGGTCGCCGAGGAATTTGCC
AGTGACTTCCCACCTGAGACGCAGAGAGCCTGGGCCAAGCTGCGTGGCCTCATCTACAGCCACGTGACCG
CTGCCTACAAGGAAGTGGGCTGGGTGCAGCAGGTCCCCAACGCCACCACCCCACCGGCCACACTGCCCTC
TTCGGGGCCGTAG
 
 

[2] The same 13 sequences with the names edited to be shorter.

 

 

>human_gi|44955876
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAG
GCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGTGCCACCGTGCTC
ACCGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC
ATGCCACCAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCA
GAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG
>chimpanzee_gi|114686145
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAG
GCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGCGCCACCGTGCTC
ACTGCCCTGGGTGGCATCCTGAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC
ATGCCACCAAGCACAAGATCCCTGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCA
CAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG
>orangutan_gi|55728441
ATGGGGCTCAGCGATGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAA
GCCACGGGCAAGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGATGAGATGAAGGCGTCTGAGGACCTAAAGAAGCATGGCGCCACCGTGCTC
ACTGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC
ATGCCACGAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATCCATCATCCAGGTTCTGCA
GAGCAAGCATCCCGGAGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG
>rhesus_gi|109094012
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAA
GCCACGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCTGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACCTAAAGAAGCATGGCGTCACCGTGCTC
ACTGCCTTGGGCGGCATCCTTAAGAAGAAGGGGCATCACGAGGCGGAGATTAAGCCCCTGGCGCAGTCGC
ATGCCACCAAGCACAAGATCCCTGTGAAGTACCTGGAGTTGATCTCGGAATCCATCATCCAAGTTCTGCA
GAGCAAGCATCCCGGGGACTTCGGTGCCGACGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AACGACATGGCCGCCAAGTACAAAGAGCTGGGCTTCCAGGGTTAG
>pig_gi|47523545
ATGGGGCTCAGCGACGGGGAATGGCAGCTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGATGTCGCAG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTTAAGGGTCACCCCGAGACCCTGGAGAAATTTGACAAGTT
TAAGCACCTGAAGTCAGAGGATGAGATGAAGGCCTCTGAGGACCTGAAGAAGCACGGCAACACGGTGCTG
ACTGCCCTGGGGGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGCTGACGCCCCTGGCCCAATCGC
ATGCCACCAAGCACAAGATCCCTGTCAAGTACCTGGAGTTCATCTCAGAAGCCATCATCCAGGTTCTGCA
GAGCAAGCATCCTGGGGACTTTGGTGCTGACGCCCAGGGAGCCATGAGCAAGGCCCTGGAACTCTTCCGG
AACGACATGGCGGCCAAGTACAAGGAGCTGGGCTTCCAGGGCTAA
>dog_gi|73969213
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACATCTGGGGGAAGGTGGAGACTGACCTGGCGG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTTAAGAACCACCCCGAGACCCTGGATAAGTTCGACAAGTT
CAAGCACCTGAAGACAGAGGATGAGATGAAGGGCTCCGAGGACCTGAAGAAGCATGGCAACACCGTGCTC
ACCGCCCTGGGGGGCATCCTTAAGAAGAAGGGGCATCACGAGGCCGAGCTGAAGCCCCTGGCCCAGTCAC
ATGCCACCAAGCACAAGATCCCCGTCAAGTACCTGGAGTTCATCTCAGATGCCATCATCCAGGTCCTGCA
GAGCAAGCATTCCGGGGACTTCCACGCCGACACCGAGGCGGCCATGAAAAAGGCCCTGGAGCTGTTCCGG
AATGACATCGCCGCCAAGTACAAGGAGCTGGGGTTCCAGGGCTAA
>spermwhale_gi|113374036
ATGGTGCTCAGCGAGGGAGAATGGCAGTTGGTTCTGCACGTCTGGGCGAAGGTGGAGGCTGATGTCGCAG
GCCATGGGCAGGACATCCTCATCAGGCTCTTTAAGAGTCATCCCGAGACCCTGGAGAAATTTGACAGGTT
CAAGCACCTGAAGACAGAGGCTGAGATGAAGGCCTCAGAGGACCTGAAGAAGCATGGCGTCACCGTGCTC
ACTGCCCTGGGGGCCATCCTCAAGAAGAAGGGGCATCATGAGGCGGAGCTGAAGCCCCTGGCCCAGTCGC
ATGCTACCAAGCACAAGATCCCCATCAAGTACCTGGAGTTCATCTCGGAAGCCATCATCCACGTTCTGCA
CAGCAGGCACCCTGGAGACTTTGGTGCCGACGCCCAGGGAGCCATGAACAAGGCCCTGGAACTGTTCCGG
AAGGACATCGCTGCCAAGTACAAGGAGCTGGGCTACCAGGGCTAA
>sheep_gi|116282340
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAATGCCTGGGGGAAGGTGGAGGCTGGTGTCGCAG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAATTTGACAAGTT
CAAGCACCTGAAGACAGAGGCTGAGATGAAGGCCTCCGAGGACCTGAAGAAGCATGGCAACACCGTGCTC
ACGGCCCTAGGGGGTATCCTGGAAAAGAAGGGTCACCACGAGGCGGAGGTGAAGCACCTGGCCGAGTCAC
ACGCCAACAAGCACAAGATCCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCTGCA
TGCCAAGCATCCTTCAGACTTCGGTGCTGATGCACAGGGCGCCATGAGCAAGGCCCTGGAACTGTTCCGG
AACGACATGGCTGCCCAGTACAAGGTGCTGGGCTTCCAGGGCTAA
>rat_gi|48976077
ATGGGGCTCAGTGATGGGGAGTGGCAGATGGTGCTGAACATCTGGGGGAAAGTGGAGGGCGACCTTGCTG
GCCATGGACAGGAAGTCCTCATCAGTCTATTTAAGGCTCACCCCGAGACCCTGGAAAAGTTCGACAAGTT
CAAGAACCTGAAATCCGAGGAAGAGATGAAGAGTTCAGAGGACCTGAAGAAGCACGGCTGCACCGTGCTC
ACAGCCCTGGGTACCATCCTGAAGAAGAAGGGACAACATGCTGCTGAGATCCAGCCTCTGGCCCAGTCCC
ACGCCACCAAGCACAAGATCCCGGTCAAGTACCTGGAGTTTATCTCAGAAGTCATCATCCAAGTCCTGAA
GAAGAGATATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCCTGGAGCTGTTCCGG
AATGACATTGCTGCCAAGTACAAGGAGCTGGGCTTCCAGGGCTGA
>mouse_gi|21359819
ATGGGGCTCAGTGATGGGGAGTGGCAGCTGGTGCTGAATGTCTGGGGGAAGGTGGAGGCCGACCTTGCTG
GCCATGGACAGGAAGTCCTCATCGGTCTGTTTAAGACTCACCCTGAGACCCTGGATAAGTTTGACAAGTT
CAAGAACTTGAAGTCAGAGGAAGATATGAAGGGCTCAGAGGACCTGAAGAAGCATGGTTGCACCGTGCTC
ACAGCCCTGGGTACCATCCTGAAGAAGAAGGGACAACATGCTGCCGAGATCCAGCCTCTAGCCCAATCAC
ACGCCACCAAGCACAAGATCCCGGTCAAGTACCTGGAGTTTATCTCAGAAATTATCATTGAAGTCCTGAA
GAAGAGACATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCCTGGAGCTCTTCCGG
AATGACATTGCCGCCAAGTACAAGGAGCTAGGCTTCCAGGGCTGA
>bovine_gi|27806938
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAATGCCTGGGGGAAGGTGGAGGCTGATGTCGCAG
GCCATGGGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAATTTGACAAGTT
CAAGCACCTGAAGACAGAGGCTGAGATGAAGGCCTCCGAGGACCTGAAGAAGCATGGCAACACGGTGCTC
ACGGCCCTGGGGGGTATCCTGAAGAAAAAGGGTCACCATGAGGCAGAGGTGAAGCACCTGGCCGAGTCAC
ATGCCAACAAGCACAAGATCCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCTACA
TGCCAAGCATCCTTCAGACTTCGGTGCTGATGCCCAGGCTGCCATGAGCAAGGCCCTGGAACTGTTCCGG
AATGACATGGCTGCCCAGTACAAGGTGCTGGGCTTCCATGGCTAA
>chicken_gi|118082891
ATGGGGCTCAGCGACCAGGAGTGGCAACAAGTCCTCACCATCTGGGGAAAAGTGGAGGCCGACATTGCTG
GCCATGGACACGAGGTTCTGATGAGACTTTTCCATGACCACCCTGAGACTTTGGATCGCTTTGATAAGTT
CAAAGGCCTGAAGACCCCTGATCAGATGAAGGGCTCTGAAGATCTGAAGAAACATGGAGCTACTGTCCTC
ACCCAGCTTGGCAAAATCCTGAAGCAGAAGGGTAATCATGAGTCAGAGCTGAAGCCCCTGGCTCAAACCC
ATGCCACGAAGCACAAAATCCCAGTCAAATATCTGGAGTTCATTTCTGAAGTCATTATCAAGGTCATTGC
TGAAAAACATGCCGCAGACTTTGGGGCCGATTCCCAGGCTGCCATGAAGAAGGCTCTGGAGTTGTTCCGA
AATGACATGGCCAGCAAGTACAAGGAGTTTGGTTTCCAGGGTTAG
>human_cytoglobin_gi|38454323
ATGGAGAAAGTGCCAGGCGAGATGGAGATCGAGCGCAGGGAGCGGAGCGAGGAGCTGTCCGAGGCGGAGA
GGAAGGCGGTGCAGGCTATGTGGGCCCGGCTCTATGCCAACTGCGAGGACGTGGGGGTGGCCATCCTGGT
GAGGTTCTTTGTGAACTTCCCCTCGGCCAAGCAGTACTTCAGCCAGTTCAAGCACATGGAGGATCCCCTG
GAGATGGAGCGGAGCCCCCAGCTGCGGAAGCACGCCTGCCGAGTCATGGGGGCCCTCAACACTGTCGTGG
AGAACCTGCATGACCCCGACAAGGTGTCCTCTGTGCTCGCCCTTGTGGGGAAAGCCCACGCCCTCAAGCA
CAAGGTGGAACCGGTGTACTTCAAGATCCTCTCTGGGGTCATTCTGGAGGTGGTCGCCGAGGAATTTGCC
AGTGACTTCCCACCTGAGACGCAGAGAGCCTGGGCCAAGCTGCGTGGCCTCATCTACAGCCACGTGACCG
CTGCCTACAAGGAAGTGGGCTGGGTGCAGCAGGTCCCCAACGCCACCACCCCACCGGCCACACTGCCCTC
TTCGGGGCCGTAG

 

[3] A multiple sequence alignment of these 13 sequences using MAFFT at EBI.

 

>human_gi|44955876
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggc
catgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacttaaagaag
catggtgccaccgtgctcaccgccctgggtggcatccttaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccaccaagcacaagatcccc
gtgaagtacctggagttcatctcggaatgcatcatccaggttctgcagagcaagcatccc
ggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>chimpanzee_gi|114686145
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggc
catgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacttaaagaag
catggcgccaccgtgctcactgccctgggtggcatcctgaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccaccaagcacaagatccct
gtgaagtacctggagttcatctcggaatgcatcatccaggttctgcacagcaagcatccc
ggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>orangutan_gi|55728441
atgg------------------------------------------------ggctcagc
gatggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaagc
cacgggcaagaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggatgagatgaaggcgtctgaggacctaaagaag
catggcgccaccgtgctcactgccctgggtggcatccttaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccacgaagcacaagatcccc
gtgaagtacctggagttcatctcggaatccatcatccaggttctgcagagcaagcatccc
ggagactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>rhesus_gi|109094012
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaagc
cacgggcaggaagtcctcatcaggctctttaagggtcaccctgagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacctaaagaag
catggcgtcaccgtgctcactgccttgggcggcatccttaagaagaaggggcatcacgag
g---------cggagattaagcccctggcgcagtcgcatgccaccaagcacaagatccct
gtgaagtacctggagttgatctcggaatccatcatccaagttctgcagagcaagcatccc
ggggacttcggtgccgacgcccagggggccatgaacaaggccctggagctgttccggaac
gacatggccgccaagtacaaagagctgggct-----------------------------
--------------------tccagggt--tag
>pig_gi|47523545
atgg------------------------------------------------ggctcagc
gacggggaatggcagctggtgctgaacgtctgggggaaggtggaggctgatgtcgcaggc
catgggcaggaggtcctcatcaggctctttaagggtcaccccgagaccctggagaaattt
gacaagtttaagcacctgaagtcagaggatgagatgaaggcctctgaggacctgaagaag
cacggcaacacggtgctgactgccctggggggcatccttaagaagaaggggcatcatgag
g---------cagagctgacgcccctggcccaatcgcatgccaccaagcacaagatccct
gtcaagtacctggagttcatctcagaagccatcatccaggttctgcagagcaagcatcct
ggggactttggtgctgacgcccagggagccatgagcaaggccctggaactcttccggaac
gacatggcggccaagtacaaggagctgggct-----------------------------
--------------------tccagggc--taa
>dog_gi|73969213
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacatctgggggaaggtggagactgacctggcgggc
catgggcaggaggtcctcatcaggctctttaagaaccaccccgagaccctggataagttc
gacaagttcaagcacctgaagacagaggatgagatgaagggctccgaggacctgaagaag
catggcaacaccgtgctcaccgccctggggggcatccttaagaagaaggggcatcacgag
g---------ccgagctgaagcccctggcccagtcacatgccaccaagcacaagatcccc
gtcaagtacctggagttcatctcagatgccatcatccaggtcctgcagagcaagcattcc
ggggacttccacgccgacaccgaggcggccatgaaaaaggccctggagctgttccggaat
gacatcgccgccaagtacaaggagctggggt-----------------------------
--------------------tccagggc--taa
>sheep_gi|116282340
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaatgcctgggggaaggtggaggctggtgtcgcaggc
catgggcaggaggtcctcatcaggctcttcacaggtcatcccgagaccctggagaaattt
gacaagttcaagcacctgaagacagaggctgagatgaaggcctccgaggacctgaagaag
catggcaacaccgtgctcacggccctagggggtatcctggaaaagaagggtcaccacgag
g---------cggaggtgaagcacctggccgagtcacacgccaacaagcacaagatccct
gtcaagtacctggagttcatctcggacgccatcatccatgttctgcatgccaagcatcct
tcagacttcggtgctgatgcacagggcgccatgagcaaggccctggaactgttccggaac
gacatggctgcccagtacaaggtgctgggct-----------------------------
--------------------tccagggc--taa
>bovine_gi|27806938
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaatgcctgggggaaggtggaggctgatgtcgcaggc
catgggcaggaggtcctcatcaggctcttcacaggtcatcccgagaccctggagaaattt
gacaagttcaagcacctgaagacagaggctgagatgaaggcctccgaggacctgaagaag
catggcaacacggtgctcacggccctggggggtatcctgaagaaaaagggtcaccatgag
g---------cagaggtgaagcacctggccgagtcacatgccaacaagcacaagatccct
gtcaagtacctggagttcatctcggacgccatcatccatgttctacatgccaagcatcct
tcagacttcggtgctgatgcccaggctgccatgagcaaggccctggaactgttccggaat
gacatggctgcccagtacaaggtgctgggct-----------------------------
--------------------tccatggc--taa
>spermwhale_gi|113374036
atgg------------------------------------------------tgctcagc
gagggagaatggcagttggttctgcacgtctgggcgaaggtggaggctgatgtcgcaggc
catgggcaggacatcctcatcaggctctttaagagtcatcccgagaccctggagaaattt
gacaggttcaagcacctgaagacagaggctgagatgaaggcctcagaggacctgaagaag
catggcgtcaccgtgctcactgccctgggggccatcctcaagaagaaggggcatcatgag
g---------cggagctgaagcccctggcccagtcgcatgctaccaagcacaagatcccc
atcaagtacctggagttcatctcggaagccatcatccacgttctgcacagcaggcaccct
ggagactttggtgccgacgcccagggagccatgaacaaggccctggaactgttccggaag
gacatcgctgccaagtacaaggagctgggct-----------------------------
--------------------accagggc--taa
>rat_gi|48976077
atgg------------------------------------------------ggctcagt
gatggggagtggcagatggtgctgaacatctgggggaaagtggagggcgaccttgctggc
catggacaggaagtcctcatcagtctatttaaggctcaccccgagaccctggaaaagttc
gacaagttcaagaacctgaaatccgaggaagagatgaagagttcagaggacctgaagaag
cacggctgcaccgtgctcacagccctgggtaccatcctgaagaagaagggacaacatgct
g---------ctgagatccagcctctggcccagtcccacgccaccaagcacaagatcccg
gtcaagtacctggagtttatctcagaagtcatcatccaagtcctgaagaagagatattcc
ggggactttggagcagatgctcagggcgccatgagcaaggccctggagctgttccggaat
gacattgctgccaagtacaaggagctgggct-----------------------------
--------------------tccagggc--tga
>mouse_gi|21359819
atgg------------------------------------------------ggctcagt
gatggggagtggcagctggtgctgaatgtctgggggaaggtggaggccgaccttgctggc
catggacaggaagtcctcatcggtctgtttaagactcaccctgagaccctggataagttt
gacaagttcaagaacttgaagtcagaggaagatatgaagggctcagaggacctgaagaag
catggttgcaccgtgctcacagccctgggtaccatcctgaagaagaagggacaacatgct
g---------ccgagatccagcctctagcccaatcacacgccaccaagcacaagatcccg
gtcaagtacctggagtttatctcagaaattatcattgaagtcctgaagaagagacattcc
ggggactttggagcagatgctcagggcgccatgagcaaggccctggagctcttccggaat
gacattgccgccaagtacaaggagctaggct-----------------------------
--------------------tccagggc--tga
>chicken_gi|118082891
atgg------------------------------------------------ggctcagc
gaccaggagtggcaacaagtcctcaccatctggggaaaagtggaggccgacattgctggc
catggacacgaggttctgatgagacttttccatgaccaccctgagactttggatcgcttt
gataagttcaaaggcctgaagacccctgatcagatgaagggctctgaagatctgaagaaa
catggagctactgtcctcacccagcttggcaaaatcctgaagcagaagggtaatcatgag
t---------cagagctgaagcccctggctcaaacccatgccacgaagcacaaaatccca
gtcaaatatctggagttcatttctgaagtcattatcaaggtcattgctgaaaaacatgcc
gcagactttggggccgattcccaggctgccatgaagaaggctctggagttgttccgaaat
gacatggccagcaagtacaaggagtttggtt-----------------------------
--------------------tccagggt--tag
>human_cytoglobin_gi|38454323
atggagaaagtgccaggcgagatggagatcgagcgcagggagcggagcgaggagctgtcc
gaggcggagaggaaggcggtgcaggctatgtgggcccggctctatgccaactgcgaggac
gtgggggtggccatcctggtgaggttctttgtgaacttcccctcggccaagcagtacttc
agccagttcaagcacatggaggatcccctggagatggagcggagcccccagctgcggaag
cacgcctgccgagtcatgggggccctcaacactgtcgtggagaacctgcatgaccccgac
aaggtgtcctctgtgctcgcccttgtggggaaagcccacgccctcaagcacaaggtggaa
ccggtgtacttcaagatcctctctggggtcattctggaggtggtcgccgaggaatttgcc
agtgacttcccacctgagacgcagagagcctgggccaagctgcgtggcctcatctacagc
cacgtgaccgctgcctacaaggaagtgggctgggtgcagcaggtccccaacgccaccacc
ccaccggccacactgccctcttcggggccgtag

 

[4] The result of converting this multiple sequence alignment into the PAUP/NEXUS format by using the ReadSeq program at Baylor College of Medicine.

 

Google ReadSeq BCM; paste the above; convert to Nexus; save as 12mb_cds.nex (plain text file using Word). Open this in PAUP (or other programs).

 

#NEXUS
[/tmp/readseq.in.12662 -- data title]
 
[Name: human_gi|44955876  Len:   573  Check:     1FEC]
[Name: chimpanzee_gi|114686145  Len:   573  Check:     1F62]
[Name: orangutan_gi|55728441  Len:   573  Check:     2159]
[Name: rhesus_gi|109094012  Len:   573  Check:     1F3B]
[Name: pig_gi|47523545   Len:   573  Check:     19E7]
[Name: dog_gi|73969213   Len:   573  Check:      1E2]
[Name: sheep_gi|116282340  Len:   573  Check:     1B2A]
[Name: bovine_gi|27806938  Len:   573  Check:     248C]
[Name: spermwhale_gi|113374036  Len:   573  Check:     13BD]
[Name: rat_gi|48976077   Len:   573  Check:     167A]
[Name: mouse_gi|21359819  Len:   573  Check:     1FCF]
[Name: chicken_gi|118082891  Len:   573  Check:      A0D]
[Name: human_cytoglobin_gi|38454323  Len:   573  Check:      470]
 
 
begin data;
 dimensions ntax=13 nchar=573;
 format datatype=dna interleave missing=-;
  matrix
human_gi|  atgg---------------- -------------------- ------------ggctcagc gacggggaatggcagttggt gctgaacgtctgggggaagg
chimpanze  atgg---------------- -------------------- ------------ggctcagc gacggggaatggcagttggt gctgaacgtctgggggaagg
orangutan  atgg---------------- -------------------- ------------ggctcagc gatggggaatggcagttggt gctgaacgtctgggggaagg
rhesus_gi  atgg---------------- -------------------- ------------ggctcagc gacggggaatggcagttggt gctgaacgtctgggggaagg
pig_gi|47  atgg---------------- -------------------- ------------ggctcagc gacggggaatggcagctggt gctgaacgtctgggggaagg
dog_gi|73  atgg---------------- -------------------- ------------ggctcagc gacggggaatggcagttggt gctgaacatctgggggaagg
sheep_gi|  atgg---------------- -------------------- ------------ggctcagc gacggggaatggcagttggt gctgaatgcctgggggaagg
bovine_gi  atgg---------------- -------------------- ------------ggctcagc gacggggaatggcagttggt gctgaatgcctgggggaagg
spermwhal  atgg---------------- -------------------- ------------tgctcagc gagggagaatggcagttggt tctgcacgtctgggcgaagg
rat_gi|48  atgg---------------- -------------------- ------------ggctcagt gatggggagtggcagatggt gctgaacatctgggggaaag
mouse_gi|  atgg---------------- -------------------- ------------ggctcagt gatggggagtggcagctggt gctgaatgtctgggggaagg
chicken_g  atgg---------------- -------------------- ------------ggctcagc gaccaggagtggcaacaagt cctcaccatctggggaaaag
human_cyt  atggagaaagtgccaggcga gatggagatcgagcgcaggg agcggagcgaggagctgtcc gaggcggagaggaaggcggt gcaggctatgtgggcccggc
 
human_gi|  tggaggctgacatcccaggc catgggcaggaagtcctcat caggctctttaagggtcacc cagagactctggagaagttt gacaagttcaagcacctgaa
chimpanze  tggaggctgacatcccaggc catgggcaggaagtcctcat caggctctttaagggtcacc cagagactctggagaagttt gacaagttcaagcacctgaa
orangutan  tggaggctgacatcccaagc cacgggcaagaagtcctcat caggctctttaagggtcacc cagagactctggagaagttt gacaagttcaagcacctgaa
rhesus_gi  tggaggctgacatcccaagc cacgggcaggaagtcctcat caggctctttaagggtcacc ctgagactctggagaagttt gacaagttcaagcacctgaa
pig_gi|47  tggaggctgatgtcgcaggc catgggcaggaggtcctcat caggctctttaagggtcacc ccgagaccctggagaaattt gacaagtttaagcacctgaa
dog_gi|73  tggagactgacctggcgggc catgggcaggaggtcctcat caggctctttaagaaccacc ccgagaccctggataagttc gacaagttcaagcacctgaa
sheep_gi|  tggaggctggtgtcgcaggc catgggcaggaggtcctcat caggctcttcacaggtcatc ccgagaccctggagaaattt gacaagttcaagcacctgaa
bovine_gi  tggaggctgatgtcgcaggc catgggcaggaggtcctcat caggctcttcacaggtcatc ccgagaccctggagaaattt gacaagttcaagcacctgaa
spermwhal  tggaggctgatgtcgcaggc catgggcaggacatcctcat caggctctttaagagtcatc ccgagaccctggagaaattt gacaggttcaagcacctgaa
rat_gi|48  tggagggcgaccttgctggc catggacaggaagtcctcat cagtctatttaaggctcacc ccgagaccctggaaaagttc gacaagttcaagaacctgaa
mouse_gi|  tggaggccgaccttgctggc catggacaggaagtcctcat cggtctgtttaagactcacc ctgagaccctggataagttt gacaagttcaagaacttgaa
chicken_g  tggaggccgacattgctggc catggacacgaggttctgat gagacttttccatgaccacc ctgagactttggatcgcttt gataagttcaaaggcctgaa
human_cyt  tctatgccaactgcgaggac gtgggggtggccatcctggt gaggttctttgtgaacttcc cctcggccaagcagtacttc agccagttcaagcacatgga
 
human_gi|  gtcagaggacgagatgaagg cgtctgaggacttaaagaag catggtgccaccgtgctcac cgccctgggtggcatcctta agaagaaggggcatcatgag
chimpanze  gtcagaggacgagatgaagg cgtctgaggacttaaagaag catggcgccaccgtgctcac tgccctgggtggcatcctga agaagaaggggcatcatgag
orangutan  gtcagaggatgagatgaagg cgtctgaggacctaaagaag catggcgccaccgtgctcac tgccctgggtggcatcctta agaagaaggggcatcatgag
rhesus_gi  gtcagaggacgagatgaagg cgtctgaggacctaaagaag catggcgtcaccgtgctcac tgccttgggcggcatcctta agaagaaggggcatcacgag
pig_gi|47  gtcagaggatgagatgaagg cctctgaggacctgaagaag cacggcaacacggtgctgac tgccctggggggcatcctta agaagaaggggcatcatgag
dog_gi|73  gacagaggatgagatgaagg gctccgaggacctgaagaag catggcaacaccgtgctcac cgccctggggggcatcctta agaagaaggggcatcacgag
sheep_gi|  gacagaggctgagatgaagg cctccgaggacctgaagaag catggcaacaccgtgctcac ggccctagggggtatcctgg aaaagaagggtcaccacgag
bovine_gi  gacagaggctgagatgaagg cctccgaggacctgaagaag catggcaacacggtgctcac ggccctggggggtatcctga agaaaaagggtcaccatgag
spermwhal  gacagaggctgagatgaagg cctcagaggacctgaagaag catggcgtcaccgtgctcac tgccctgggggccatcctca agaagaaggggcatcatgag
rat_gi|48  atccgaggaagagatgaaga gttcagaggacctgaagaag cacggctgcaccgtgctcac agccctgggtaccatcctga agaagaagggacaacatgct
mouse_gi|  gtcagaggaagatatgaagg gctcagaggacctgaagaag catggttgcaccgtgctcac agccctgggtaccatcctga agaagaagggacaacatgct
chicken_g  gacccctgatcagatgaagg gctctgaagatctgaagaaa catggagctactgtcctcac ccagcttggcaaaatcctga agcagaagggtaatcatgag
human_cyt  ggatcccctggagatggagc ggagcccccagctgcggaag cacgcctgccgagtcatggg ggccctcaacactgtcgtgg agaacctgcatgaccccgac
 
human_gi|  g---------cagagattaa gcccctggcacagtcgcatg ccaccaagcacaagatcccc gtgaagtacctggagttcat ctcggaatgcatcatccagg
chimpanze  g---------cagagattaa gcccctggcacagtcgcatg ccaccaagcacaagatccct gtgaagtacctggagttcat ctcggaatgcatcatccagg
orangutan  g---------cagagattaa gcccctggcacagtcgcatg ccacgaagcacaagatcccc gtgaagtacctggagttcat ctcggaatccatcatccagg
rhesus_gi  g---------cggagattaa gcccctggcgcagtcgcatg ccaccaagcacaagatccct gtgaagtacctggagttgat ctcggaatccatcatccaag
pig_gi|47  g---------cagagctgac gcccctggcccaatcgcatg ccaccaagcacaagatccct gtcaagtacctggagttcat ctcagaagccatcatccagg
dog_gi|73  g---------ccgagctgaa gcccctggcccagtcacatg ccaccaagcacaagatcccc gtcaagtacctggagttcat ctcagatgccatcatccagg
sheep_gi|  g---------cggaggtgaa gcacctggccgagtcacacg ccaacaagcacaagatccct gtcaagtacctggagttcat ctcggacgccatcatccatg
bovine_gi  g---------cagaggtgaa gcacctggccgagtcacatg ccaacaagcacaagatccct gtcaagtacctggagttcat ctcggacgccatcatccatg
spermwhal  g---------cggagctgaa gcccctggcccagtcgcatg ctaccaagcacaagatcccc atcaagtacctggagttcat ctcggaagccatcatccacg
rat_gi|48  g---------ctgagatcca gcctctggcccagtcccacg ccaccaagcacaagatcccg gtcaagtacctggagtttat ctcagaagtcatcatccaag
mouse_gi|  g---------ccgagatcca gcctctagcccaatcacacg ccaccaagcacaagatcccg gtcaagtacctggagtttat ctcagaaattatcattgaag
chicken_g  t---------cagagctgaa gcccctggctcaaacccatg ccacgaagcacaaaatccca gtcaaatatctggagttcat ttctgaagtcattatcaagg
human_cyt  aaggtgtcctctgtgctcgc ccttgtggggaaagcccacg ccctcaagcacaaggtggaa ccggtgtacttcaagatcct ctctggggtcattctggagg
 
human_gi|  ttctgcagagcaagcatccc ggggactttggtgctgatgc ccagggggccatgaacaagg ccctggagctgttccggaag gacatggcctccaactacaa
chimpanze  ttctgcacagcaagcatccc ggggactttggtgctgatgc ccagggggccatgaacaagg ccctggagctgttccggaag gacatggcctccaactacaa
orangutan  ttctgcagagcaagcatccc ggagactttggtgctgatgc ccagggggccatgaacaagg ccctggagctgttccggaag gacatggcctccaactacaa
rhesus_gi  ttctgcagagcaagcatccc ggggacttcggtgccgacgc ccagggggccatgaacaagg ccctggagctgttccggaac gacatggccgccaagtacaa
pig_gi|47  ttctgcagagcaagcatcct ggggactttggtgctgacgc ccagggagccatgagcaagg ccctggaactcttccggaac gacatggcggccaagtacaa
dog_gi|73  tcctgcagagcaagcattcc ggggacttccacgccgacac cgaggcggccatgaaaaagg ccctggagctgttccggaat gacatcgccgccaagtacaa
sheep_gi|  ttctgcatgccaagcatcct tcagacttcggtgctgatgc acagggcgccatgagcaagg ccctggaactgttccggaac gacatggctgcccagtacaa
bovine_gi  ttctacatgccaagcatcct tcagacttcggtgctgatgc ccaggctgccatgagcaagg ccctggaactgttccggaat gacatggctgcccagtacaa
spermwhal  ttctgcacagcaggcaccct ggagactttggtgccgacgc ccagggagccatgaacaagg ccctggaactgttccggaag gacatcgctgccaagtacaa
rat_gi|48  tcctgaagaagagatattcc ggggactttggagcagatgc tcagggcgccatgagcaagg ccctggagctgttccggaat gacattgctgccaagtacaa
mouse_gi|  tcctgaagaagagacattcc ggggactttggagcagatgc tcagggcgccatgagcaagg ccctggagctcttccggaat gacattgccgccaagtacaa
chicken_g  tcattgctgaaaaacatgcc gcagactttggggccgattc ccaggctgccatgaagaagg ctctggagttgttccgaaat gacatggccagcaagtacaa
human_cyt  tggtcgccgaggaatttgcc agtgacttcccacctgagac gcagagagcctgggccaagc tgcgtggcctcatctacagc cacgtgaccgctgcctacaa
 
human_gi|  ggagctgggct--------- -------------------- -------------------- tccagggc--tag
chimpanze  ggagctgggct--------- -------------------- -------------------- tccagggc--tag
orangutan  ggagctgggct--------- -------------------- -------------------- tccagggc--tag
rhesus_gi  agagctgggct--------- -------------------- -------------------- tccagggt--tag
pig_gi|47  ggagctgggct--------- -------------------- -------------------- tccagggc--taa
dog_gi|73  ggagctggggt--------- -------------------- -------------------- tccagggc--taa
sheep_gi|  ggtgctgggct--------- -------------------- -------------------- tccagggc--taa
bovine_gi  ggtgctgggct--------- -------------------- -------------------- tccatggc--taa
spermwhal  ggagctgggct--------- -------------------- -------------------- accagggc--taa
rat_gi|48  ggagctgggct--------- -------------------- -------------------- tccagggc--tga
mouse_gi|  ggagctaggct--------- -------------------- -------------------- tccagggc--tga
chicken_g  ggagtttggtt--------- -------------------- -------------------- tccagggt--tag
human_cyt  ggaagtgggctgggtgcagc aggtccccaacgccaccacc ccaccggccacactgccctc ttcggggccgtag
 
;
  end;

 

 

[5] A multiple sequence alignment of these 13 sequences using ProbCons (Chapter 6), displayed in the ClustalW format.

 

PROBCONS version 1.1 multiple sequence alignment

human_gi|44955876               AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
chimpanzee_gi|114686145         AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
orangutan_gi|55728441           AT---------------------GGGGCTC-AGCGATGGGGAATGGCAGTTGGTGCTGAA
rhesus_gi|109094012             AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
pig_gi|47523545                 AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGCTGGTGCTGAA
dog_gi|73969213                 AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
spermwhale_gi|113374036         AT---------------------GGTGCTC-AGCGAGGGAGAATGGCAGTTGGTTCTGCA
sheep_gi|116282340              AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
rat_gi|48976077                 AT---------------------GGGGCTC-AGTGATGGGGAGTGGCAGATGGTGCTGAA
mouse_gi|21359819               AT---------------------GGGGCTC-AGTGATGGGGAGTGGCAGCTGGTGCTGAA
bovine_gi|27806938              AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
chicken_gi|118082891            AT---------------------GGGGCTC-AGCGACCAGGAGTGGCAACAAGTCCTCAC
human_cytoglobin_gi|38454323    ATGGAGAAAGTGCCAGGCGAGATGGAGATCGAGCG-CAGGGAGCGGAGCGAGGAGCTGTC
                                **                     ** *.** ** **  ..**. **..  :.*: **  .

human_gi|44955876               CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAGG
chimpanzee_gi|114686145         CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAGG
orangutan_gi|55728441           CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAAG
rhesus_gi|109094012             CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAAG
pig_gi|47523545                 CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ATGTCGCAGG
dog_gi|73969213                 CAT--CTGGG-GGAAGGTGG---AGACTG---------------------ACCTGGCGGG
spermwhale_gi|113374036         CGT--CTGGG-CGAAGGTGG---AGGCTG---------------------ATGTCGCAGG
sheep_gi|116282340              TGC--CTGGG-GGAAGGTGG---AGGCTG---------------------GTGTCGCAGG
rat_gi|48976077                 CAT--CTGGG-GGAAAGTGG---AGGGCG---------------------ACCTTGCTGG
mouse_gi|21359819               TGT--CTGGG-GGAAGGTGG---AGGCCG---------------------ACCTTGCTGG
bovine_gi|27806938              TGC--CTGGG-GGAAGGTGG---AGGCTG---------------------ATGTCGCAGG
chicken_gi|118082891            CAT--CTGGG-GAAAAGTGG---AGGCCG---------------------ACATTGCTGG
human_cytoglobin_gi|38454323    CGAGGCGGAGAGGAAGGCGGTGCAGGCTATGTGGGCCCGGCTCTATGCCAACTGC-GAGG
                                 .   * *.*  .**.* **   **.  .                     .       .*

human_gi|44955876               CCATG-GGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGT
chimpanzee_gi|114686145         CCATG-GGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGT
orangutan_gi|55728441           CCACG-GGCAAGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGT
rhesus_gi|109094012             CCACG-GGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCTGAGACTCTGGAGAAGT
pig_gi|47523545                 CCATG-GGCAGGAGGTCCTCATCAGGCTCTTTAAGGGTCACCCCGAGACCCTGGAGAAAT
dog_gi|73969213                 CCATG-GGCAGGAGGTCCTCATCAGGCTCTTTAAGAACCACCCCGAGACCCTGGATAAGT
spermwhale_gi|113374036         CCATG-GGCAGGACATCCTCATCAGGCTCTTTAAGAGTCATCCCGAGACCCTGGAGAAAT
sheep_gi|116282340              CCATG-GGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAAT
rat_gi|48976077                 CCATG-GACAGGAAGTCCTCATCAGTCTATTTAAGGCTCACCCCGAGACCCTGGAAAAGT
mouse_gi|21359819               CCATG-GACAGGAAGTCCTCATCGGTCTGTTTAAGACTCACCCTGAGACCCTGGATAAGT
bovine_gi|27806938              CCATG-GGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAAT
chicken_gi|118082891            CCATG-GACACGAGGTTCTGATGAGACTTTTCCATGACCACCCTGAGACTTTGGATCGCT
human_cytoglobin_gi|38454323    ACGTGGGGGTGGCCATCCTGGTGAGGTTCTTTGTGAACTTCCCCTCGGCCAAGCAGTACT
                                .*. * *. : *. .* ** .* .*  * **    .   : **  .*.*  :* *  . *

human_gi|44955876               TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGACGAGATGAAGGCGTCTGAGGACTT
chimpanzee_gi|114686145         TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGACGAGATGAAGGCGTCTGAGGACTT
orangutan_gi|55728441           TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGATGAGATGAAGGCGTCTGAGGACCT
rhesus_gi|109094012             TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGACGAGATGAAGGCGTCTGAGGACCT
pig_gi|47523545                 TTGACAAGTTTAAGCACCTGAAGT--C---AGAGGATGAGATGAAGGCCTCTGAGGACCT
dog_gi|73969213                 TCGACAAGTTCAAGCACCTGAAGA--C---AGAGGATGAGATGAAGGGCTCCGAGGACCT
spermwhale_gi|113374036         TTGACAGGTTCAAGCACCTGAAGA--C---AGAGGCTGAGATGAAGGCCTCAGAGGACCT
sheep_gi|116282340              TTGACAAGTTCAAGCACCTGAAGA--C---AGAGGCTGAGATGAAGGCCTCCGAGGACCT
rat_gi|48976077                 TCGACAAGTTCAAGAACCTGAAAT--C---CGAGGAAGAGATGAAGAGTTCAGAGGACCT
mouse_gi|21359819               TTGACAAGTTCAAGAACTTGAAGT--C---AGAGGAAGATATGAAGGGCTCAGAGGACCT
bovine_gi|27806938              TTGACAAGTTCAAGCACCTGAAGA--C---AGAGGCTGAGATGAAGGCCTCCGAGGACCT
chicken_gi|118082891            TTGATAAGTTCAAAGGCCTGAAGA--C---CCCTGATCAGATGAAGGGCTCTGAAGATCT
human_cytoglobin_gi|38454323    TCAGCCAGTTCAAGCACATGGAGGATCCCCTGGAGATGGAGCGGAGCCCCCAG-----CT
                                * .. ..*** **. .* **.*.   *       *.  . . *.**    * **.**  *

human_gi|44955876               AAAGAAGCATGGTGCCACCG------------TGCTCACCGCCCTGGGTGGCAT-CCTTA
chimpanzee_gi|114686145         AAAGAAGCATGGCGCCACCG------------TGCTCACTGCCCTGGGTGGCAT-CCTGA
orangutan_gi|55728441           AAAGAAGCATGGCGCCACCG------------TGCTCACTGCCCTGGGTGGCAT-CCTTA
rhesus_gi|109094012             AAAGAAGCATGGCGTCACCG------------TGCTCACTGCCTTGGGCGGCAT-CCTTA
pig_gi|47523545                 GAAGAAGCACGGCAACACGG------------TGCTGACTGCCCTGGGGGGCAT-CCTTA
dog_gi|73969213                 GAAGAAGCATGGCAACACCG------------TGCTCACCGCCCTGGGGGGCAT-CCTTA
spermwhale_gi|113374036         GAAGAAGCATGGCGTCACCG------------TGCTCACTGCCCTGGGGGCCAT-CCTCA
sheep_gi|116282340              GAAGAAGCATGGCAACACCG------------TGCTCACGGCCCTAGGGGGTAT-CCTGG
rat_gi|48976077                 GAAGAAGCACGGCTGCACCG------------TGCTCACAGCCCTGGGTACCAT-CCTGA
mouse_gi|21359819               GAAGAAGCATGGTTGCACCG------------TGCTCACAGCCCTGGGTACCAT-CCTGA
bovine_gi|27806938              GAAGAAGCATGGCAACACGG------------TGCTCACGGCCCTGGGGGGTAT-CCTGA
chicken_gi|118082891            GAAGAAACATGGAGCTACTG------------TCCTCACCCAGCTTGGCAAAAT-CCTGA
human_cytoglobin_gi|38454323    GCGGAAGCACGCCTGCCGAGTCATGGGGGCCCTCAACACTGTCGTGGAGAACCTGCATGA
                                ...***.** *     .  *            * .: **     * *. .  .* *.* .

human_gi|44955876               AGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCC--TGGCACAGTCGCATGCCACCAA
chimpanzee_gi|114686145         AGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCC--TGGCACAGTCGCATGCCACCAA
orangutan_gi|55728441           AGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCC--TGGCACAGTCGCATGCCACGAA
rhesus_gi|109094012             AGAAGAAGGGGCATCACGAGGCGGAGATTAAGCCCC--TGGCGCAGTCGCATGCCACCAA
pig_gi|47523545                 AGAAGAAGGGGCATCATGAGGCAGAGCTGACGCCCC--TGGCCCAATCGCATGCCACCAA
dog_gi|73969213                 AGAAGAAGGGGCATCACGAGGCCGAGCTGAAGCCCC--TGGCCCAGTCACATGCCACCAA
spermwhale_gi|113374036         AGAAGAAGGGGCATCATGAGGCGGAGCTGAAGCCCC--TGGCCCAGTCGCATGCTACCAA
sheep_gi|116282340              AAAAGAAGGGTCACCACGAGGCGGAGGTGAAGCACC--TGGCCGAGTCACACGCCAACAA
rat_gi|48976077                 AGAAGAAGGGACAACATGCTGCTGAGATCCAGCCTC--TGGCCCAGTCCCACGCCACCAA
mouse_gi|21359819               AGAAGAAGGGACAACATGCTGCCGAGATCCAGCCTC--TAGCCCAATCACACGCCACCAA
bovine_gi|27806938              AGAAAAAGGGTCACCATGAGGCAGAGGTGAAGCACC--TGGCCGAGTCACATGCCAACAA
chicken_gi|118082891            AGCAGAAGGGTAATCATGAGTCAGAGCTGAAGCCCC--TGGCTCAAACCCATGCCACGAA
human_cytoglobin_gi|38454323    CCCCGACAAGGTGTCCT----CTGTGCT--CGCCCTTGTGGGGAAAGCCCACGCCCTCAA
                                . ...*...*  . *. *.  * *:* * ..**.    *.*   *. * ** ** .  **

human_gi|44955876               GCACAAGAT---CCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCT
chimpanzee_gi|114686145         GCACAAGAT---CCCTGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCT
orangutan_gi|55728441           GCACAAGAT---CCCCGTGAAGTACCTGGAGTTCATCTCGGAATCCATCATCCAGGTTCT
rhesus_gi|109094012             GCACAAGAT---CCCTGTGAAGTACCTGGAGTTGATCTCGGAATCCATCATCCAAGTTCT
pig_gi|47523545                 GCACAAGAT---CCCTGTCAAGTACCTGGAGTTCATCTCAGAAGCCATCATCCAGGTTCT
dog_gi|73969213                 GCACAAGAT---CCCCGTCAAGTACCTGGAGTTCATCTCAGATGCCATCATCCAGGTCCT
spermwhale_gi|113374036         GCACAAGAT---CCCCATCAAGTACCTGGAGTTCATCTCGGAAGCCATCATCCACGTTCT
sheep_gi|116282340              GCACAAGAT---CCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCT
rat_gi|48976077                 GCACAAGAT---CCCGGTCAAGTACCTGGAGTTTATCTCAGAAGTCATCATCCAAGTCCT
mouse_gi|21359819               GCACAAGAT---CCCGGTCAAGTACCTGGAGTTTATCTCAGAAATTATCATTGAAGTCCT
bovine_gi|27806938              GCACAAGAT---CCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCT
chicken_gi|118082891            GCACAAAAT---CCCAGTCAAATATCTGGAGTTCATTTCTGAAGTCATTATCAAGGTCAT
human_cytoglobin_gi|38454323    GCACAAGGTGGAACCGGT---GTACTTCAAGATCCTCTCTGGGGTCATTCTGGAGGTGGT
                                ******..*   .** .* **.**  * .**:* .* ** *.    ** .*  * **  *

human_gi|44955876               -GCAGAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCC
chimpanzee_gi|114686145         -GCACAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCC
orangutan_gi|55728441           -GCAGAGCAAGCATCCCGGAGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCC
rhesus_gi|109094012             -GCAGAGCAAGCATCCCGGGGACTTCGGTGCCGACGCCCAGGGGGCCATGAACAAGGCCC
pig_gi|47523545                 -GCAGAGCAAGCATCCTGGGGACTTTGGTGCTGACGCCCAGGGAGCCATGAGCAAGGCCC
dog_gi|73969213                 -GCAGAGCAAGCATTCCGGGGACTTCCACGCCGACACCGAGGCGGCCATGAAAAAGGCCC
spermwhale_gi|113374036         -GCACAGCAGGCACCCTGGAGACTTTGGTGCCGACGCCCAGGGAGCCATGAACAAGGCCC
sheep_gi|116282340              -GCATGCCAAGCATCCTTCAGACTTCGGTGCTGATGCACAGGGCGCCATGAGCAAGGCCC
rat_gi|48976077                 -GAAGAAGAGATATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCC
mouse_gi|21359819               -GAAGAAGAGACATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCC
bovine_gi|27806938              -ACATGCCAAGCATCCTTCAGACTTCGGTGCTGATGCCCAGGCTGCCATGAGCAAGGCCC
chicken_gi|118082891            TGCTGA-AAAACATGCCGCAGACTTTGGGGCCGATTCCCAGGCTGCCATGAAGAAGGCTC
human_cytoglobin_gi|38454323    CGCCGAGGA-ATTTGCCAGTGACTTCCCACCTGAGACGCAGAGAGCCTGGGCCAAGCTGC
                                 ..  .  *.. :  *    *****     * **  *  **.  ***: *.  ***   *

human_gi|44955876               TGGAGCTGTTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCT------------
chimpanzee_gi|114686145         TGGAGCTGTTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCT------------
orangutan_gi|55728441           TGGAGCTGTTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCT------------
rhesus_gi|109094012             TGGAGCTGTTCCGGAACGACATGGCCGCCAAGTACAAAGAGCTGGGCT------------
pig_gi|47523545                 TGGAACTCTTCCGGAACGACATGGCGGCCAAGTACAAGGAGCTGGGCT------------
dog_gi|73969213                 TGGAGCTGTTCCGGAATGACATCGCCGCCAAGTACAAGGAGCTGGGGT------------
spermwhale_gi|113374036         TGGAACTGTTCCGGAAGGACATCGCTGCCAAGTACAAGGAGCTGGGCT------------
sheep_gi|116282340              TGGAACTGTTCCGGAACGACATGGCTGCCCAGTACAAGGTGCTGGGCT------------
rat_gi|48976077                 TGGAGCTGTTCCGGAATGACATTGCTGCCAAGTACAAGGAGCTGGGCT------------
mouse_gi|21359819               TGGAGCTCTTCCGGAATGACATTGCCGCCAAGTACAAGGAGCTAGGCT------------
bovine_gi|27806938              TGGAACTGTTCCGGAATGACATGGCTGCCCAGTACAAGGTGCTGGGCT------------
chicken_gi|118082891            TGGAGTTGTTCCGAAATGACATGGCCAGCAAGTACAAGGAGTTTGGTT------------
human_cytoglobin_gi|38454323    GTGGCCTCATCTACAGCCACGTGACCGCTGCCTACAAGGAAGTGGGCTGGGTGCAGCAGG
                                  *.  * :** . *.  **.* .*     . *****.*:. * ** *            

human_gi|44955876               -------------------------------------TCCAGGGC--TAG
chimpanzee_gi|114686145         -------------------------------------TCCAGGGC--TAG
orangutan_gi|55728441           -------------------------------------TCCAGGGC--TAG
rhesus_gi|109094012             -------------------------------------TCCAGGGT--TAG
pig_gi|47523545                 -------------------------------------TCCAGGGC--TAA
dog_gi|73969213                 -------------------------------------TCCAGGGC--TAA
spermwhale_gi|113374036         -------------------------------------ACCAGGGC--TAA
sheep_gi|116282340              -------------------------------------TCCAGGGC--TAA
rat_gi|48976077                 -------------------------------------TCCAGGGC--TGA
mouse_gi|21359819               -------------------------------------TCCAGGGC--TGA
bovine_gi|27806938              -------------------------------------TCCATGGC--TAA
chicken_gi|118082891            -------------------------------------TCCAGGGT--TAG
human_cytoglobin_gi|38454323    TCCCCAACGCCACCACCCCACCGGCCACACTGCCCTCTTCGGGGCCGTAG
                                                                     : *. **   *..

 

[6] A multiple sequence alignment of these 13 sequences using ProbCons (Chapter 6), displayed in the MFA format.

 

 

 

>human_gi|44955876
AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAGG
CCATG-GGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGT
TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGACGAGATGAAGGCGTCTGAGGACTT
AAAGAAGCATGGTGCCACCG------------TGCTCACCGCCCTGGGTGGCAT-CCTTA
AGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCC--TGGCACAGTCGCATGCCACCAA
GCACAAGAT---CCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCT
-GCAGAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCC
TGGAGCTGTTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCT------------
-------------------------------------TCCAGGGC--TAG
>chimpanzee_gi|114686145
AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAGG
CCATG-GGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGT
TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGACGAGATGAAGGCGTCTGAGGACTT
AAAGAAGCATGGCGCCACCG------------TGCTCACTGCCCTGGGTGGCAT-CCTGA
AGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCC--TGGCACAGTCGCATGCCACCAA
GCACAAGAT---CCCTGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCT
-GCACAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCC
TGGAGCTGTTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCT------------
-------------------------------------TCCAGGGC--TAG
>orangutan_gi|55728441
AT---------------------GGGGCTC-AGCGATGGGGAATGGCAGTTGGTGCTGAA
CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAAG
CCACG-GGCAAGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGT
TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGATGAGATGAAGGCGTCTGAGGACCT
AAAGAAGCATGGCGCCACCG------------TGCTCACTGCCCTGGGTGGCAT-CCTTA
AGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCC--TGGCACAGTCGCATGCCACGAA
GCACAAGAT---CCCCGTGAAGTACCTGGAGTTCATCTCGGAATCCATCATCCAGGTTCT
-GCAGAGCAAGCATCCCGGAGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCC
TGGAGCTGTTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCT------------
-------------------------------------TCCAGGGC--TAG
>rhesus_gi|109094012
AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ACATCCCAAG
CCACG-GGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCTGAGACTCTGGAGAAGT
TTGACAAGTTCAAGCACCTGAAGT--C---AGAGGACGAGATGAAGGCGTCTGAGGACCT
AAAGAAGCATGGCGTCACCG------------TGCTCACTGCCTTGGGCGGCAT-CCTTA
AGAAGAAGGGGCATCACGAGGCGGAGATTAAGCCCC--TGGCGCAGTCGCATGCCACCAA
GCACAAGAT---CCCTGTGAAGTACCTGGAGTTGATCTCGGAATCCATCATCCAAGTTCT
-GCAGAGCAAGCATCCCGGGGACTTCGGTGCCGACGCCCAGGGGGCCATGAACAAGGCCC
TGGAGCTGTTCCGGAACGACATGGCCGCCAAGTACAAAGAGCTGGGCT------------
-------------------------------------TCCAGGGT--TAG
>pig_gi|47523545
AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGCTGGTGCTGAA
CGT--CTGGG-GGAAGGTGG---AGGCTG---------------------ATGTCGCAGG
CCATG-GGCAGGAGGTCCTCATCAGGCTCTTTAAGGGTCACCCCGAGACCCTGGAGAAAT
TTGACAAGTTTAAGCACCTGAAGT--C---AGAGGATGAGATGAAGGCCTCTGAGGACCT
GAAGAAGCACGGCAACACGG------------TGCTGACTGCCCTGGGGGGCAT-CCTTA
AGAAGAAGGGGCATCATGAGGCAGAGCTGACGCCCC--TGGCCCAATCGCATGCCACCAA
GCACAAGAT---CCCTGTCAAGTACCTGGAGTTCATCTCAGAAGCCATCATCCAGGTTCT
-GCAGAGCAAGCATCCTGGGGACTTTGGTGCTGACGCCCAGGGAGCCATGAGCAAGGCCC
TGGAACTCTTCCGGAACGACATGGCGGCCAAGTACAAGGAGCTGGGCT------------
-------------------------------------TCCAGGGC--TAA
>dog_gi|73969213
AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
CAT--CTGGG-GGAAGGTGG---AGACTG---------------------ACCTGGCGGG
CCATG-GGCAGGAGGTCCTCATCAGGCTCTTTAAGAACCACCCCGAGACCCTGGATAAGT
TCGACAAGTTCAAGCACCTGAAGA--C---AGAGGATGAGATGAAGGGCTCCGAGGACCT
GAAGAAGCATGGCAACACCG------------TGCTCACCGCCCTGGGGGGCAT-CCTTA
AGAAGAAGGGGCATCACGAGGCCGAGCTGAAGCCCC--TGGCCCAGTCACATGCCACCAA
GCACAAGAT---CCCCGTCAAGTACCTGGAGTTCATCTCAGATGCCATCATCCAGGTCCT
-GCAGAGCAAGCATTCCGGGGACTTCCACGCCGACACCGAGGCGGCCATGAAAAAGGCCC
TGGAGCTGTTCCGGAATGACATCGCCGCCAAGTACAAGGAGCTGGGGT------------
-------------------------------------TCCAGGGC--TAA
>spermwhale_gi|113374036
AT---------------------GGTGCTC-AGCGAGGGAGAATGGCAGTTGGTTCTGCA
CGT--CTGGG-CGAAGGTGG---AGGCTG---------------------ATGTCGCAGG
CCATG-GGCAGGACATCCTCATCAGGCTCTTTAAGAGTCATCCCGAGACCCTGGAGAAAT
TTGACAGGTTCAAGCACCTGAAGA--C---AGAGGCTGAGATGAAGGCCTCAGAGGACCT
GAAGAAGCATGGCGTCACCG------------TGCTCACTGCCCTGGGGGCCAT-CCTCA
AGAAGAAGGGGCATCATGAGGCGGAGCTGAAGCCCC--TGGCCCAGTCGCATGCTACCAA
GCACAAGAT---CCCCATCAAGTACCTGGAGTTCATCTCGGAAGCCATCATCCACGTTCT
-GCACAGCAGGCACCCTGGAGACTTTGGTGCCGACGCCCAGGGAGCCATGAACAAGGCCC
TGGAACTGTTCCGGAAGGACATCGCTGCCAAGTACAAGGAGCTGGGCT------------
-------------------------------------ACCAGGGC--TAA
>sheep_gi|116282340
AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
TGC--CTGGG-GGAAGGTGG---AGGCTG---------------------GTGTCGCAGG
CCATG-GGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAAT
TTGACAAGTTCAAGCACCTGAAGA--C---AGAGGCTGAGATGAAGGCCTCCGAGGACCT
GAAGAAGCATGGCAACACCG------------TGCTCACGGCCCTAGGGGGTAT-CCTGG
AAAAGAAGGGTCACCACGAGGCGGAGGTGAAGCACC--TGGCCGAGTCACACGCCAACAA
GCACAAGAT---CCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCT
-GCATGCCAAGCATCCTTCAGACTTCGGTGCTGATGCACAGGGCGCCATGAGCAAGGCCC
TGGAACTGTTCCGGAACGACATGGCTGCCCAGTACAAGGTGCTGGGCT------------
-------------------------------------TCCAGGGC--TAA
>rat_gi|48976077
AT---------------------GGGGCTC-AGTGATGGGGAGTGGCAGATGGTGCTGAA
CAT--CTGGG-GGAAAGTGG---AGGGCG---------------------ACCTTGCTGG
CCATG-GACAGGAAGTCCTCATCAGTCTATTTAAGGCTCACCCCGAGACCCTGGAAAAGT
TCGACAAGTTCAAGAACCTGAAAT--C---CGAGGAAGAGATGAAGAGTTCAGAGGACCT
GAAGAAGCACGGCTGCACCG------------TGCTCACAGCCCTGGGTACCAT-CCTGA
AGAAGAAGGGACAACATGCTGCTGAGATCCAGCCTC--TGGCCCAGTCCCACGCCACCAA
GCACAAGAT---CCCGGTCAAGTACCTGGAGTTTATCTCAGAAGTCATCATCCAAGTCCT
-GAAGAAGAGATATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCC
TGGAGCTGTTCCGGAATGACATTGCTGCCAAGTACAAGGAGCTGGGCT------------
-------------------------------------TCCAGGGC--TGA
>mouse_gi|21359819
AT---------------------GGGGCTC-AGTGATGGGGAGTGGCAGCTGGTGCTGAA
TGT--CTGGG-GGAAGGTGG---AGGCCG---------------------ACCTTGCTGG
CCATG-GACAGGAAGTCCTCATCGGTCTGTTTAAGACTCACCCTGAGACCCTGGATAAGT
TTGACAAGTTCAAGAACTTGAAGT--C---AGAGGAAGATATGAAGGGCTCAGAGGACCT
GAAGAAGCATGGTTGCACCG------------TGCTCACAGCCCTGGGTACCAT-CCTGA
AGAAGAAGGGACAACATGCTGCCGAGATCCAGCCTC--TAGCCCAATCACACGCCACCAA
GCACAAGAT---CCCGGTCAAGTACCTGGAGTTTATCTCAGAAATTATCATTGAAGTCCT
-GAAGAAGAGACATTCCGGGGACTTTGGAGCAGATGCTCAGGGCGCCATGAGCAAGGCCC
TGGAGCTCTTCCGGAATGACATTGCCGCCAAGTACAAGGAGCTAGGCT------------
-------------------------------------TCCAGGGC--TGA
>bovine_gi|27806938
AT---------------------GGGGCTC-AGCGACGGGGAATGGCAGTTGGTGCTGAA
TGC--CTGGG-GGAAGGTGG---AGGCTG---------------------ATGTCGCAGG
CCATG-GGCAGGAGGTCCTCATCAGGCTCTTCACAGGTCATCCCGAGACCCTGGAGAAAT
TTGACAAGTTCAAGCACCTGAAGA--C---AGAGGCTGAGATGAAGGCCTCCGAGGACCT
GAAGAAGCATGGCAACACGG------------TGCTCACGGCCCTGGGGGGTAT-CCTGA
AGAAAAAGGGTCACCATGAGGCAGAGGTGAAGCACC--TGGCCGAGTCACATGCCAACAA
GCACAAGAT---CCCTGTCAAGTACCTGGAGTTCATCTCGGACGCCATCATCCATGTTCT
-ACATGCCAAGCATCCTTCAGACTTCGGTGCTGATGCCCAGGCTGCCATGAGCAAGGCCC
TGGAACTGTTCCGGAATGACATGGCTGCCCAGTACAAGGTGCTGGGCT------------
-------------------------------------TCCATGGC--TAA
>chicken_gi|118082891
AT---------------------GGGGCTC-AGCGACCAGGAGTGGCAACAAGTCCTCAC
CAT--CTGGG-GAAAAGTGG---AGGCCG---------------------ACATTGCTGG
CCATG-GACACGAGGTTCTGATGAGACTTTTCCATGACCACCCTGAGACTTTGGATCGCT
TTGATAAGTTCAAAGGCCTGAAGA--C---CCCTGATCAGATGAAGGGCTCTGAAGATCT
GAAGAAACATGGAGCTACTG------------TCCTCACCCAGCTTGGCAAAAT-CCTGA
AGCAGAAGGGTAATCATGAGTCAGAGCTGAAGCCCC--TGGCTCAAACCCATGCCACGAA
GCACAAAAT---CCCAGTCAAATATCTGGAGTTCATTTCTGAAGTCATTATCAAGGTCAT
TGCTGA-AAAACATGCCGCAGACTTTGGGGCCGATTCCCAGGCTGCCATGAAGAAGGCTC
TGGAGTTGTTCCGAAATGACATGGCCAGCAAGTACAAGGAGTTTGGTT------------
-------------------------------------TCCAGGGT--TAG
>human_cytoglobin_gi|38454323
ATGGAGAAAGTGCCAGGCGAGATGGAGATCGAGCG-CAGGGAGCGGAGCGAGGAGCTGTC
CGAGGCGGAGAGGAAGGCGGTGCAGGCTATGTGGGCCCGGCTCTATGCCAACTGC-GAGG
ACGTGGGGGTGGCCATCCTGGTGAGGTTCTTTGTGAACTTCCCCTCGGCCAAGCAGTACT
TCAGCCAGTTCAAGCACATGGAGGATCCCCTGGAGATGGAGCGGAGCCCCCAG-----CT
GCGGAAGCACGCCTGCCGAGTCATGGGGGCCCTCAACACTGTCGTGGAGAACCTGCATGA
CCCCGACAAGGTGTCCT----CTGTGCT--CGCCCTTGTGGGGAAAGCCCACGCCCTCAA
GCACAAGGTGGAACCGGT---GTACTTCAAGATCCTCTCTGGGGTCATTCTGGAGGTGGT
CGCCGAGGA-ATTTGCCAGTGACTTCCCACCTGAGACGCAGAGAGCCTGGGCCAAGCTGC
GTGGCCTCATCTACAGCCACGTGACCGCTGCCTACAAGGAAGTGGGCTGGGTGCAGCAGG
TCCCCAACGCCACCACCCCACCGGCCACACTGCCCTCTTCGGGGCCGTAG