Web document 7.4. Test for positive or negative selection using SNAP software.

 

Contents of this document:

[1] 4 DNA coding sequences of myoglobins.

[2] SNAP website

[3] Paste

[4] Optional parameters

[5] Results

 

[1] We introduced myoglobin sequences in web document 7.3. Here we test for selection using just four sequences (human, chimpanzee, orangutan, rhesus monkey) aligned with MAFFT, taken from that document.

 

>human_gi|44955876
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggc
catgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacttaaagaag
catggtgccaccgtgctcaccgccctgggtggcatccttaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccaccaagcacaagatcccc
gtgaagtacctggagttcatctcggaatgcatcatccaggttctgcagagcaagcatccc
ggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>chimpanzee_gi|114686145
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggc
catgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacttaaagaag
catggcgccaccgtgctcactgccctgggtggcatcctgaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccaccaagcacaagatccct
gtgaagtacctggagttcatctcggaatgcatcatccaggttctgcacagcaagcatccc
ggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>orangutan_gi|55728441
atgg------------------------------------------------ggctcagc
gatggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaagc
cacgggcaagaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggatgagatgaaggcgtctgaggacctaaagaag
catggcgccaccgtgctcactgccctgggtggcatccttaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccacgaagcacaagatcccc
gtgaagtacctggagttcatctcggaatccatcatccaggttctgcagagcaagcatccc
ggagactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>rhesus_gi|109094012
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaagc
cacgggcaggaagtcctcatcaggctctttaagggtcaccctgagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacctaaagaag
catggcgtcaccgtgctcactgccttgggcggcatccttaagaagaaggggcatcacgag
g---------cggagattaagcccctggcgcagtcgcatgccaccaagcacaagatccct
gtgaagtacctggagttgatctcggaatccatcatccaagttctgcagagcaagcatccc
ggggacttcggtgccgacgcccagggggccatgaacaaggccctggagctgttccggaac
gacatggccgccaagtacaaagagctgggct-----------------------------
--------------------tccagggt--tag

 

[2] Go to the SNAP website (http://www.hiv.lanl.gov/content/hiv-db/SNAP/WEBSNAP/SNAP.html). You can also use a search engine (enter lanl hiv) to get to the HIV database, then choose the tools menu.

 

[3] Paste in the sequences.

 

[4] Enter optional parameters if you want; click run.

 

[5] The result is shown here; note the low number of nonsynonymous (relative to synonymous) substitutions.

 

 

 

Sequences_names

Sd

Sn

S

N

ps

pn

ds

dn

ds/dn

 

 

 

 

 

 

 

 

 

 

 

 

 

0

1

human

chimpanzee

4

1

98.17

357.83

0.0407

0.0028

0.0407

0.0028

14.5806

 

 

 

 

 

 

 

 

 

 

 

 

 

0

2

human

orangutan

9

2

98.33

357.67

0.0915

0.0056

0.0915

0.0056

16.3678

 

 

 

 

 

 

 

 

 

 

 

 

 

0

3

human

rhesus

15

7

98.17

357.83

0.1528

0.0196

0.1528

0.0196

7.8111

 

 

 

 

 

 

 

 

 

 

 

 

 

1

2

chimpanzee

orangutan

9

3

98.5

357.5

0.0914

0.0084

0.0914

0.0084

10.8883

 

 

 

 

 

 

 

 

 

 

 

 

 

1

3

chimpanzee

rhesus

13

8

98.33

357.67

0.1322

0.0224

0.1322

0.0224

5.9106

 

 

 

 

 

 

 

 

 

 

 

 

 

2

3

orangutan

rhesus

16

5

98.5

357.5

0.1624

0.014

0.1624

0.014

11.6142

 

 

 

 

 

 

 

 

 

 

 

 

 

Averages of all pairwise comparisons: ds =  0.1118, dn =  0.0121, ds/dn = 11.1954

 

 

Averages of the first sequence compared to others: ds =  0.0950, dn =  0.0093, ds/dn = 12.9198

 

 

Compare:Lists the two sequences compared, starting with 0 (4 sequences are seqs 0-3)

Sequences_names:The names of the two sequences being compared.

Sd:The number of observed synonymous substitutions

Sn:The number of observed non-synonymous substitutions

S:The number of potential synonymous substitutions (the average for the two compared sequences)

N:The number of potential non-synonymous substitutions (the average for the two compared sequences)

ps:The proportion of observed synonymous substitutions: Sd/S

pn:The proportion of observed non-synonymous substitutions: Sn/N

ds:The Jukes-Cantor correction for multiple hits of ps

dn:The Jukes-Cantor correction for multiple hits of pn

ds/dn:The ratio of synonymous to non-synonymous substitutions