Web document 7.5. Test for positive or negative selection using MEGA software.

 

Myoglobin sequences used for phylogenetic analyses. The file contains 12 myoglobin DNA coding sequences and human cytoglobin (as an outgroup).

 

Contents of this document:

[1] 13 DNA coding sequences were obtained from NCBI Nucleotide. Note that each begins with ATG and ends with a stop codon (TAG, TGA, or TAG). A multiple sequence alignment of these 13 sequences was created using MAFFT at EBI.

[2] Obtain MEGA software

[3] Enter the alignment

[4] Go to the selection menu

[5] Result using a Codon-Based Z-Test

[6] Result using a Codon-Based Fisher’s Exact Test

 

 

 

[1] Obtain a multiple sequence alignment of 13 coding sequences using MAFFT at EBI. Simply copy step [3] of web document 7.3.

 

>human_gi|44955876
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggc
catgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacttaaagaag
catggtgccaccgtgctcaccgccctgggtggcatccttaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccaccaagcacaagatcccc
gtgaagtacctggagttcatctcggaatgcatcatccaggttctgcagagcaagcatccc
ggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>chimpanzee_gi|114686145
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggc
catgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacttaaagaag
catggcgccaccgtgctcactgccctgggtggcatcctgaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccaccaagcacaagatccct
gtgaagtacctggagttcatctcggaatgcatcatccaggttctgcacagcaagcatccc
ggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>orangutan_gi|55728441
atgg------------------------------------------------ggctcagc
gatggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaagc
cacgggcaagaagtcctcatcaggctctttaagggtcacccagagactctggagaagttt
gacaagttcaagcacctgaagtcagaggatgagatgaaggcgtctgaggacctaaagaag
catggcgccaccgtgctcactgccctgggtggcatccttaagaagaaggggcatcatgag
g---------cagagattaagcccctggcacagtcgcatgccacgaagcacaagatcccc
gtgaagtacctggagttcatctcggaatccatcatccaggttctgcagagcaagcatccc
ggagactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaag
gacatggcctccaactacaaggagctgggct-----------------------------
--------------------tccagggc--tag
>rhesus_gi|109094012
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaagc
cacgggcaggaagtcctcatcaggctctttaagggtcaccctgagactctggagaagttt
gacaagttcaagcacctgaagtcagaggacgagatgaaggcgtctgaggacctaaagaag
catggcgtcaccgtgctcactgccttgggcggcatccttaagaagaaggggcatcacgag
g---------cggagattaagcccctggcgcagtcgcatgccaccaagcacaagatccct
gtgaagtacctggagttgatctcggaatccatcatccaagttctgcagagcaagcatccc
ggggacttcggtgccgacgcccagggggccatgaacaaggccctggagctgttccggaac
gacatggccgccaagtacaaagagctgggct-----------------------------
--------------------tccagggt--tag
>pig_gi|47523545
atgg------------------------------------------------ggctcagc
gacggggaatggcagctggtgctgaacgtctgggggaaggtggaggctgatgtcgcaggc
catgggcaggaggtcctcatcaggctctttaagggtcaccccgagaccctggagaaattt
gacaagtttaagcacctgaagtcagaggatgagatgaaggcctctgaggacctgaagaag
cacggcaacacggtgctgactgccctggggggcatccttaagaagaaggggcatcatgag
g---------cagagctgacgcccctggcccaatcgcatgccaccaagcacaagatccct
gtcaagtacctggagttcatctcagaagccatcatccaggttctgcagagcaagcatcct
ggggactttggtgctgacgcccagggagccatgagcaaggccctggaactcttccggaac
gacatggcggccaagtacaaggagctgggct-----------------------------
--------------------tccagggc--taa
>dog_gi|73969213
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaacatctgggggaaggtggagactgacctggcgggc
catgggcaggaggtcctcatcaggctctttaagaaccaccccgagaccctggataagttc
gacaagttcaagcacctgaagacagaggatgagatgaagggctccgaggacctgaagaag
catggcaacaccgtgctcaccgccctggggggcatccttaagaagaaggggcatcacgag
g---------ccgagctgaagcccctggcccagtcacatgccaccaagcacaagatcccc
gtcaagtacctggagttcatctcagatgccatcatccaggtcctgcagagcaagcattcc
ggggacttccacgccgacaccgaggcggccatgaaaaaggccctggagctgttccggaat
gacatcgccgccaagtacaaggagctggggt-----------------------------
--------------------tccagggc--taa
>sheep_gi|116282340
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaatgcctgggggaaggtggaggctggtgtcgcaggc
catgggcaggaggtcctcatcaggctcttcacaggtcatcccgagaccctggagaaattt
gacaagttcaagcacctgaagacagaggctgagatgaaggcctccgaggacctgaagaag
catggcaacaccgtgctcacggccctagggggtatcctggaaaagaagggtcaccacgag
g---------cggaggtgaagcacctggccgagtcacacgccaacaagcacaagatccct
gtcaagtacctggagttcatctcggacgccatcatccatgttctgcatgccaagcatcct
tcagacttcggtgctgatgcacagggcgccatgagcaaggccctggaactgttccggaac
gacatggctgcccagtacaaggtgctgggct-----------------------------
--------------------tccagggc--taa
>bovine_gi|27806938
atgg------------------------------------------------ggctcagc
gacggggaatggcagttggtgctgaatgcctgggggaaggtggaggctgatgtcgcaggc
catgggcaggaggtcctcatcaggctcttcacaggtcatcccgagaccctggagaaattt
gacaagttcaagcacctgaagacagaggctgagatgaaggcctccgaggacctgaagaag
catggcaacacggtgctcacggccctggggggtatcctgaagaaaaagggtcaccatgag
g---------cagaggtgaagcacctggccgagtcacatgccaacaagcacaagatccct
gtcaagtacctggagttcatctcggacgccatcatccatgttctacatgccaagcatcct
tcagacttcggtgctgatgcccaggctgccatgagcaaggccctggaactgttccggaat
gacatggctgcccagtacaaggtgctgggct-----------------------------
--------------------tccatggc--taa
>spermwhale_gi|113374036
atgg------------------------------------------------tgctcagc
gagggagaatggcagttggttctgcacgtctgggcgaaggtggaggctgatgtcgcaggc
catgggcaggacatcctcatcaggctctttaagagtcatcccgagaccctggagaaattt
gacaggttcaagcacctgaagacagaggctgagatgaaggcctcagaggacctgaagaag
catggcgtcaccgtgctcactgccctgggggccatcctcaagaagaaggggcatcatgag
g---------cggagctgaagcccctggcccagtcgcatgctaccaagcacaagatcccc
atcaagtacctggagttcatctcggaagccatcatccacgttctgcacagcaggcaccct
ggagactttggtgccgacgcccagggagccatgaacaaggccctggaactgttccggaag
gacatcgctgccaagtacaaggagctgggct-----------------------------
--------------------accagggc--taa
>rat_gi|48976077
atgg------------------------------------------------ggctcagt
gatggggagtggcagatggtgctgaacatctgggggaaagtggagggcgaccttgctggc
catggacaggaagtcctcatcagtctatttaaggctcaccccgagaccctggaaaagttc
gacaagttcaagaacctgaaatccgaggaagagatgaagagttcagaggacctgaagaag
cacggctgcaccgtgctcacagccctgggtaccatcctgaagaagaagggacaacatgct
g---------ctgagatccagcctctggcccagtcccacgccaccaagcacaagatcccg
gtcaagtacctggagtttatctcagaagtcatcatccaagtcctgaagaagagatattcc
ggggactttggagcagatgctcagggcgccatgagcaaggccctggagctgttccggaat
gacattgctgccaagtacaaggagctgggct-----------------------------
--------------------tccagggc--tga
>mouse_gi|21359819
atgg------------------------------------------------ggctcagt
gatggggagtggcagctggtgctgaatgtctgggggaaggtggaggccgaccttgctggc
catggacaggaagtcctcatcggtctgtttaagactcaccctgagaccctggataagttt
gacaagttcaagaacttgaagtcagaggaagatatgaagggctcagaggacctgaagaag
catggttgcaccgtgctcacagccctgggtaccatcctgaagaagaagggacaacatgct
g---------ccgagatccagcctctagcccaatcacacgccaccaagcacaagatcccg
gtcaagtacctggagtttatctcagaaattatcattgaagtcctgaagaagagacattcc
ggggactttggagcagatgctcagggcgccatgagcaaggccctggagctcttccggaat
gacattgccgccaagtacaaggagctaggct-----------------------------
--------------------tccagggc--tga
>chicken_gi|118082891
atgg------------------------------------------------ggctcagc
gaccaggagtggcaacaagtcctcaccatctggggaaaagtggaggccgacattgctggc
catggacacgaggttctgatgagacttttccatgaccaccctgagactttggatcgcttt
gataagttcaaaggcctgaagacccctgatcagatgaagggctctgaagatctgaagaaa
catggagctactgtcctcacccagcttggcaaaatcctgaagcagaagggtaatcatgag
t---------cagagctgaagcccctggctcaaacccatgccacgaagcacaaaatccca
gtcaaatatctggagttcatttctgaagtcattatcaaggtcattgctgaaaaacatgcc
gcagactttggggccgattcccaggctgccatgaagaaggctctggagttgttccgaaat
gacatggccagcaagtacaaggagtttggtt-----------------------------
--------------------tccagggt--tag
>human_cytoglobin_gi|38454323
atggagaaagtgccaggcgagatggagatcgagcgcagggagcggagcgaggagctgtcc
gaggcggagaggaaggcggtgcaggctatgtgggcccggctctatgccaactgcgaggac
gtgggggtggccatcctggtgaggttctttgtgaacttcccctcggccaagcagtacttc
agccagttcaagcacatggaggatcccctggagatggagcggagcccccagctgcggaag
cacgcctgccgagtcatgggggccctcaacactgtcgtggagaacctgcatgaccccgac
aaggtgtcctctgtgctcgcccttgtggggaaagcccacgccctcaagcacaaggtggaa
ccggtgtacttcaagatcctctctggggtcattctggaggtggtcgccgaggaatttgcc
agtgacttcccacctgagacgcagagagcctgggccaagctgcgtggcctcatctacagc
cacgtgaccgctgcctacaaggaagtgggctgggtgcagcaggtccccaacgccaccacc
ccaccggccacactgccctcttcggggccgtag

 

[2] Obtain MEGA software.

 

[3] Using the Alignment Explorer (under the Alignment menu), create a new alignment. Paste in the multiple sequence alignment. Save it as a .mas and a .meg file.

 

[4] Open the .meg file. The selection menu is shown here:

 

Choose Codon-Based Z-Test.

 

[5] The result is shown here, along with the caption provided by MEGA4 software.

 

 

 

Table. Codon-based Test of Neutrality for analysis analysis between sequences.

The probability of rejecting the null hypothesis of strict-neutrality (dN = dS) (below diagonal) is shown. Values of P less than 0.05 are considered significant at the 5% level and are highlighted. The test statistic (dN - dS) is shown above the diagonal. dS and dN are the numbers of synonymous and nonsynonymous substitutions per site, respectively. The variance of the difference was computed using the bootstrap method (500 replicates). Analyses were conducted using the Nei-Gojobori method in MEGA4 [1, 2]. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 121 positions in the final dataset.



1. Nei M & Gojobori T (1986) Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and Evolution 3:418-426.

2. Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 10.1093/molbev/msm092.

[6] The results using the Codon-Based Fisher’s Exact test are shown, along with the caption provided by MEGA4.

 

 

Table. Results from Fisher's Exact Test of Neutrality for Sequence Pairs

The probability (P) of rejecting the null hypothesis of strict-neutrality in favor of the alternative hypothesis of positive selection is shown for each sequence pair [1]. P values smaller than 0.05 are considered significant at the 5% level and are highlighted. The numbers of synonymous and nonsynonymous differences between sequences were estimated using the Nei-Gojobori method in MEGA4 [2, 3]. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 121 codons in the final dataset.

 

1. Zhang J, Kumar S & Nei M (1997) Small-sample tests of episodic adaptive evolution: a case study of primate lysozymes. Molecular Biology and Evolution 14:1335-1338.

2. Nei M & Gojobori T (1986) Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and Evolution 3:418-426.

3. Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 10.1093/molbev/msm092.