Web document 7.12. Six primate mitochondrial DNA sequences in the NEXUS format. You can select the sequences (beginning at the #NEXUS) and paste them into MEGA.

 

#NEXUS

[ Title 6_primate_mito]

begin taxa;

   dimensions ntax= 6;

   taxlabels

      human__Homo_sapiens_

      bonobo__Pan_paniscus_

      chimpanzee__Pan_troglodytes_

      gorilla__Gorilla_gorilla_

      orangutan__Pongo_pygmaeus_

      gibbon__Hylobates_lar_

;

end;

begin characters;

   dimensions nchar= 896;

   format missing=? gap=- matchchar=. datatype=nucleotide interleave=yes;

   matrix

 

[!Domain=Data property=Coding CodonStart=1;]

human_(Homo_sapiens)         AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGACTCACATCCTCATTACTATTCTGCCTAGCAAACTCAAA

bonobo_(Pan_paniscus)        AAGCTTCACCGGCGCAGTCATTCTTATAATCGCCCACGGACTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAA

chimpanzee_(Pan_troglodytes) AAGCTTCACCGGCGCAATTATCCTCATAATCGCCCACGGACTTACATCCTCATTATTATCCTGCCTAGCAAACTCAAA

gorilla_(Gorilla_gorilla)    AAGCTTCACCGGCGCAGTTGTTCTTATAATTGCCCACGGACTTACATCATCATTATTATTCTGCCTAGCAAACTCAAA

orangutan_(Pongo_pygmaeus)   AAGCTTCACCGGCGCAACCACCCTCATGATTGCCCACGGACTCACATCCTCCCTACTATTCTGCCTAGCAAACTCAAA

gibbon_(Hylobates_lar)       AAGCTTTACAGGTGCAACCGTCCTCATAATCGCCCACGGACTAACCTCTTCCCTGCTATTCTGCCTTGCAAACTCAAA

 

human_(Homo_sapiens)         CTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATG

bonobo_(Pan_paniscus)        TTACGAACGCACCCACAGTCGCATCATAATTCTCTCCCAAGGACTTCAAACTCTACTCCCACTAATAGCCTTTTGATG

chimpanzee_(Pan_troglodytes) TTATGAACGCACCCACAGTCGCATCATAATTCTCTCCCAAGGACTTCAAACTCTACTCCCACTAATAGCCTTTTGATG

gorilla_(Gorilla_gorilla)    CTACGAACGAACCCACAGCCGCATCATAATTCTCTCTCAAGGACTCCAAACCCTACTCCCACTAATAGCCCTTTGATG

orangutan_(Pongo_pygmaeus)   CTACGAACGAACCCACAGCCGCATCATAATCCTCTCTCAAGGCCTTCAAACTCTACTCCCCCTGATAGCCCTCTGATG

gibbon_(Hylobates_lar)       CTACGAACGAACTCACAGCCGCATCATAATCCTATCTCGAGGGCTCCAAGCCTTACTCCCACTGATAGCCTTCTGATG

 

human_(Homo_sapiens)         ACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCAC

bonobo_(Pan_paniscus)        ACTCCTAGCAAGCCTCGCCAACCTCGCCCTACCCCCCACCATTAATCTCCTAGGAGAACTCTCCGTGCTAGTAACCTC

chimpanzee_(Pan_troglodytes) ACTCCTGGCAAGCCTCGCTAACCTCGCCCTACCCCCTACCATTAATCTCCTAGGGGAACTCTCCGTGCTAGTAACCTC

gorilla_(Gorilla_gorilla)    ACTTCTGGCAAGCCTCGCCAACCTCGCCTTACCCCCCACCATTAACCTACTAGGAGAGCTCTCCGTACTAGTAACCAC

orangutan_(Pongo_pygmaeus)   ACTTCTAGCAAGCCTCACTAACCTTGCCCTACCACCCACCATCAACCTACTAGGAGAGCTCTCCGTACTAATAGCCAT

gibbon_(Hylobates_lar)       ACTCGCAGCAAGCCTCGCTAACCTCGCCCTACCCCCCACTATTAACCTCCTAGGTGAACTCTTCGTACTAATGGCCTC

 

human_(Homo_sapiens)         GTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATT

bonobo_(Pan_paniscus)        ATTCTCCTGATCAAATACTACCCTCCTACTCACAGGATTCAACATACTAATTACAGCCCTGTACTCCCTCTACATGTT

chimpanzee_(Pan_troglodytes) ATTCTCCTGATCAAATACCACTCTCCTACTCACAGGATTCAACATACTAATCACAGCCCTGTACTCCCTCTACATGTT

gorilla_(Gorilla_gorilla)    ATTCTCCTGATCAAACACCACCCTTTTACTTACAGGATCTAACATACTAATTACAGCCCTGTACTCCCTTTATATATT

orangutan_(Pongo_pygmaeus)   ATTCTCTTGATCTAACATCACCATCCTACTAACAGGACTCAACATATTAATCACAGCCCTATACTCCCTCTACATATT

gibbon_(Hylobates_lar)       CTTCTCCTGGGCAAACACTACTATTACACTCACCGGGCTCAACGTACTAATCACGGCCCTATACTCTCTTTACATATT

 

human_(Homo_sapiens)         TACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCAT

bonobo_(Pan_paniscus)        TACCACAACACAATGAGGCTCACTCACCCACCACATTAATAACATAAAACCCTCATTCACACGAGAAAACACTCTCAT

chimpanzee_(Pan_troglodytes) TACCACAACACAATGAGGCTCACTCACCCACCACATTAATAGCATAAAGCCCTCATTCACACGAGAAAACACTCTCAT

gorilla_(Gorilla_gorilla)    TACCACAACACAATGAGGCCCACTCACACACCACATCACCAACATAAAACCCTCATTTACACGAGAAAACATCCTCAT

orangutan_(Pongo_pygmaeus)   CATCACAACACAACGAGGCACACCCTCACACCACATCAACAACATAAAACCCTCTTCCACACGTGAAAACACCCTCAT

gibbon_(Hylobates_lar)       TATCATAACACAACGAGGCACACTTACACACCACATTAAAAACATAAAACCCTCACTCACACGAGAAAACATATTAAT

 

human_(Homo_sapiens)         GTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAG

bonobo_(Pan_paniscus)        ATTTATACACCTATCCCCCATCCTCCTCCTATCCCTCAATCCTGATATTATCACTGGATTCACCTCCTGTAAATATAG

chimpanzee_(Pan_troglodytes) ATTTTTACACCTATCCCCCATCCTCCTTCTATCCCTCAATCCTGATATCATCACTGGATTCACCTCCTGTAAATATAG

gorilla_(Gorilla_gorilla)    ATTCATGCACCTATCCCCCATCCTCCTCCTATCCCTCAACCCCGATATTATCACCGGGTTTACCTCCTGTAAATATAG

orangutan_(Pongo_pygmaeus)   GCTCATACACCTATTCCCTATCCTCCTCCTATCCCTCAACCCCAGCATCATTGCTGGGCTCACCTACTGTAAATATAG

gibbon_(Hylobates_lar)       ACTTATGCACCTCTTCCCCCTCCTCCTCCTAACCCTCAACCCTAACATCATTACTGGCTTTACTCCCTGTAAACATAG

 

human_(Homo_sapiens)         TTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACT

bonobo_(Pan_paniscus)        TTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTCACGACCCCTTATTTACCGAGAAAGCTTATAAGAACT

chimpanzee_(Pan_troglodytes) TTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTCACGACCCCTTATTTACCGAGAAAGCTTATAAGAACT

gorilla_(Gorilla_gorilla)    TTTAACCAAAACATCAGATTGTGAATCTGATAACAGAGGCTCACAACCCCTTATTTACCGAGAAAGCTCGTAAGAGCT

orangutan_(Pongo_pygmaeus)   TTTAACCAAAACATTAGATTGTGAATCTAATAATAGGGCCCCACAACCCCTTATTTACCGAGAAAGCTCACAAGAACT

gibbon_(Hylobates_lar)       TTTAATCAAAACATTAGATTGTGAATCTAACAATAGAGGCTCGAAACCTCTTGCTTACCGAGAAAGCCCACAAGAACT

 

human_(Homo_sapiens)         GCTAACTCATGCCCCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCC

bonobo_(Pan_paniscus)        GCTAATTCATATCCCCATGCCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCCATCCGTTGGTCTTAGGCC

chimpanzee_(Pan_troglodytes) GCTAACTCGTATTCCCATGCCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGTTATCCATTGGTCTTAGGCC

gorilla_(Gorilla_gorilla)    GCTAACTCATACCCCCGTGCTTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGAC

orangutan_(Pongo_pygmaeus)   GCTAACTCCCA-CCCCATGTATAACAACATGGCTTTCTCGACTTTTAAAGGATAACAGCTATCCCTTGGTCTTAGGAC

gibbon_(Hylobates_lar)       GCTAACTCACTATCCCATGTATAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGAC

 

human_(Homo_sapiens)         CCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTA

bonobo_(Pan_paniscus)        CCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGTATACTACCATAACCACCTTAACCCTAACTCCCTTA

chimpanzee_(Pan_troglodytes) CCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGTATGCTACCATAACCACCTTAGCCCTAACTTCCTTA

gorilla_(Gorilla_gorilla)    CCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACTATGTACGCTACCATAACCACCTTAGCCCTAACTTCCTTA

orangutan_(Pongo_pygmaeus)   CCAAAAATTTTGGTGCAACTCCAAATAAAAGTAACAGCCATGTTCACCACCATAACCGCCCTCACCTTAACTTCCCTA

gibbon_(Hylobates_lar)       CCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAGCAATGTACACCACCATAGCCATTCTAACGCTAACCTCCCTA

 

human_(Homo_sapiens)         ATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCA

bonobo_(Pan_paniscus)        ATTCTCCCCATCCTCACCACCCTCATTAACCCTAACAAAAAAAACTCATATCCCCATTATGTGAAATCCATTATCGCG

chimpanzee_(Pan_troglodytes) ATTCCCCCCATCCTCGGCGCCCTCATTAACCCTAACAAAAAAAACTCATACCCCCATTACGTGAAATCCATTATCGCA

gorilla_(Gorilla_gorilla)    ATTCCCCCTATCCTTACCACCTTCATCAATCCTAACAAAAAAAGCTCATACCCCCATTACGTAAAATCTATCGTCGCA

orangutan_(Pongo_pygmaeus)   ATCCCCCCCATTACCGCTACCCTCATCAACCCCAACAAAAAGAACTCATACCCCCACTATGTAAAAACGGCTATCGCA

gibbon_(Hylobates_lar)       ATTCCCCCCATTACAGCCACCCTTATTAACCCCAATAAAAAGAACTTATACCCGCACTACGTAAAAATGACCATTGCC

 

human_(Homo_sapiens)         TCCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACAC

bonobo_(Pan_paniscus)        TCCACCTTTATCATTAGCCTTTTCCCCACAACAATATTCATATGCCTAGACCAAGAAGCTATTATCTCAAACTGGCAC

chimpanzee_(Pan_troglodytes) TCCACCTTTATCATTAGCCTTTTCCCCACAACAATATTCATATGCCTAGACCAAGAAACTATTATCTCGAACTGACAC

gorilla_(Gorilla_gorilla)    TCCACCTTTATCATCAGCCTCTTCCCCACAACAATATTTCTATGCCTAGACCAAGAAGCTATTATCTCAAGCTGACAC

orangutan_(Pongo_pygmaeus)   TCCGCCTTTACTATCAGCCTTATCCCAACAACAATATTTATCTGCCTAGGGCAAGAAACCATCATCACAAACTGATGT

gibbon_(Hylobates_lar)       TCTACCTTTATAATCAGCCTATTTCCCACAATAATATTCATGTGCACAGACCAAGAAACCATTATTTCAAACTGACAC

 

human_(Homo_sapiens)         TGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTT

bonobo_(Pan_paniscus)        TGAGCAACAACCCAAACAACCCAGCTCTCCCTAAGCTT

chimpanzee_(Pan_troglodytes) TGAGCAACAACCCAAACAACCCAACTCTCCCTGAGCTT

gorilla_(Gorilla_gorilla)    TGAGCAACAACCCAAACAATTCAACTCTCCCTAAGCTT

orangutan_(Pongo_pygmaeus)   TGAACAACCACCCAAACACTGCAACTCTCACTAAGCTT

gibbon_(Hylobates_lar)       TGAACTGCAACCCAAACGCTAGAACTCTCCCTAAGCTT

;

end;